SimpleSearch - Line and FST details


Line specific information

 
Line ID 314F05
Vector Used pAC161
Line Availability only available from NASC (N430113)
Segregation Analysis 100:96:94
Confirmed for Hit At1g74430
Parent of DUPLO pair 2725
Parent of pair(s) none

Gene hit At1g74430

 
Sequence (A. th genome BLAST matches underlined)
>38-K015819-022-314-F05-8409
TTAGGAATTAGAAATTTTATTGATAAATGGATTTTACAAATACAACTACATGCTACGGGT
TTCTTATATGCTCAACACATGAGCGAAAGCCTATAACAACCCTAATATACCCTGATCTGG
GAACTACTCACGCATGATTATAGAGAGACATAGATTTGTACAGAGACACTGGTGATTGCT
GCTGGCATGCCTGCACGTCGACCTCCTGCCATACTATGAGATCCTCCGAAATAATGAGAC
CATCCTCTGACCCTTGACTCTTCTAGATCTACCCGCCACACAGCTAGATGTCACCTCCGC
ATCCTCTACGTAGTCTGATACACCGAGCCCTACTTCTTCTTCTTTTTCCACCTGGACCTC
TACTGGCTCTGCACGTTTCCTTAACAAGCTCGCTGCTGGAATCTCGGCAAGAAAACGCGG
ACTATGGGATCCTCGCGTATAGTGAGATTTTAACTTGTGCTATGGGATCCTCCCTATAGG
GA
GenBank Accession BX890967 [GenBank]
Graphic View Graphic view of gene At1g74430
Predicted Position of Insertion Chr1:27976382 - go to primer design
BLAST e Value 6e-46
Hit Clone Code (BAC ID) F1M20
Hit Gene Code At1g74430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 95
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g28020

 
Sequence (A. th genome BLAST matches underlined)
>38-K015823-022-314-F05-8409
GATCCTGTAGATTTCCCGTCAGGATTGTCATTTCCGACGCAGCAGCGGATAGCCGCTATC
GACATCGGAGAGCACGCCGAACGCGGTTACCTATGGGATCCTCCCTATAGTGAGAGACAG
CCGCTCCCGTAATTACCAGTTGCTACCGATTTGACTCCCGGAGCGATACATTCCTCGACG
AAGACGGAACGTTCCACTCGCTCGTCGCAGCAAAGAGCCCATCTATGGCTACGTCAAGAC
GCTCCCACGGCTCTACCTCGGCGGATTTTAGCCTTTACACTCGCCGTAGTATCTGTATCC
GCTGCCTTCTCGCGTAATCTCTTTCTCTCTACCTCTCTGTCACTTCCTCTTCCCAATACC
TGTTATTGAGCTGGTTTCTAGAAACTAACACTTTATTGAGCATGTTCTTGCGAAGTGTAT
AGATGGCGACTACGACAAGAAGATTTGGAGAATAGGATCACGGAATTTGATAAGTCTTTG
GGATCTACCTTGGAAAAAAGAGCTTCTGAGAGAAAAGGTCGAGTCTGAGCTCAGCAGGTG
AGTTTTTTTTTAACTTGCACTATGGGATCCT
GenBank Accession AL948705 [GenBank]
Graphic View Graphic view of gene At4g28020
Predicted Position of Insertion Chr4:13935327 - go to primer design
BLAST e Value 2e-160
Hit Clone Code (BAC ID) T13J8
Hit Gene Code At4g28020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation tRNA-thr(GGU) m(6)t(6)A37 methyltransferase
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 07.07.2016 14:03