Sequences from confirmation amplicon


Confirmation sequences for line 322H06 and hit At2g31660 are shown.
Line ID 322H06
Locus At2g31660 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:13470234
Primers used for PCR CK32 - 8474, show primer details
   
Sequence Name 33-K017887-022-322-H06C-CK32
GenBank Accession LN500798 [GenBank]
Sequencing primer gene specific primer, CK32: 5'-TCTGGAGTCCATTCATTTCTTCTT-3'
Sequence (A. th genome BLAST matches underlined)
>33-K017887-022-322-H06C-CK32
ATCTACTTCTGTCTCCTTAGCTGCTTCTGCGAGGAAGATTGGAAAGGGAATAAATGTAAA
GATTACCATGCCAAGTGAAGAGAAAATGGATCATGACTCATGAGCAGGACATACCAGCTA
GCTGATTCTTATATGCAACTAGAAGATCAAGTGTTGCCCTGAAAACACGCTGCAGCGCTT
CATCGGGGAATTGACCCCCAGGGAGAGCAAGTAATGAAGTCAAACCCAAGCAGCAAACCT
TTTTATCATGTTCCCTGGTACCAAGAGAGTAACAACCCCTTTATCAGCTATCAAAGCGAA
CAATAGAATTTCCAACCATTACGCTTATAAGTTAACATGAACAAGATGTGACATAACAAA
AATCATCAACAGTACCTTTTGAAGTTTGCTGGCAGGCCACTTTTTCTCTTTTGCTGCAAC
ATCTGGAACCAAAGGTCAAAGACTTTGGAAGCAAGTCCTGTGTTATGCAATACACCAAGC
ATATTAATCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATAT
GGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAG
CGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTA
TAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACA
   
Sequence Name 34-K017887-022-322-H06C-8409
GenBank Accession LN501223 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>34-K017887-022-322-H06C-8409
CATGTAGATTTCCCGGACATGAAGATTAATATGCTTGGTGTATTGCATAACACAGGACTT
GCTTCCAAAGTCTTTGACCTTTGGTTCCAGATGTTGCAGCAAAAGAGAAAAAGTGGCCTG
CCAGCAAACTTCAAAAGGTACTGTTGATGATTTTTGTTATGTCACATCTTGTTCATGTTA
ACTTATAAGCGTAATGGTTGGAAATTCTATTGTTCGCTTTGATAGCTGATAAAGGGGTTG
TTACTCTCTTGGTACCAGGGAACATGATAAAAAGGTTTGCTGCTTGGGTTTGACTTCATT
ACTTGCTCTCCCTGGGGGTCAATTCCCCGATGAAGCGCTGCAGCGTGTTTTCAGGGCAAC
ACTTGATCTTCTAGTTGCATATAAAAATCACCTAGCTGGTATGTCCTGCTCATGAGTCAT
GATCCATTTTCTCTTCACTTGGCATGGAAATCTTTACATTTATTCCCTTTCCAATCTTCC

Last Updated on 23.10.2014 13:25