SimpleSearch - Line and FST details


Line specific information

 
Line ID 322H06
Vector Used pAC161
Line Availability only available from NASC (N430906)
Segregation Analysis 100:97:93
Confirmed for Hit At2g31660
Parent of DUPLO pair 1415
Parent of pair(s) 4536

Gene hit AP22

 
Sequence (A. th genome BLAST matches underlined)
>48-K015950-022-322-H06-8409
ACATTGAAGTCATGGGTCCGTGTGAGACAACAAATCTTGCCCCTTATAGAAATCAATTAA
ATTAAAATACAAGCCCTCATGACCATTAACATATTAACGAAGTGACGACTTCAGTGACGA
AATTAGGTTCATCTTAGATTTAATAATCCAGAAAATTCGTACTTAATAACTTATATTACT
TTTAAAATTTCTGCAGACAGTTTCTACTCATGGACCGACTGATTCCTTATCGTATGATTA
AAAATATTATTTGACTAAACTAATTATAAAGTTTCGAATTTCCCCATGAAGTCTGCATTC
ATTGGTCTATCGTACCGCTTCCTCGTACACTAATCTCCACTTGCCTTCAAACCCTATGGG
ACTCCCTAATATGTGGAGAATCACCTGCCCTTTGCAATTCTGGAAAACAACTTCAATAAG
CTTTGGAGCAGACTCAATTTTCACTGTCTTCTATGTTTCTGTCGGNCATAAGCTGTAGAA
GTGGAAACGTGAGACATATATAAGCTATCCTTGTGCGGAAAAACATAAGAGATGCTTATA
TATATATTAGCAAAAAAATGGCATGTAGTACTGAATGTAACATATAGTATTCCTATGGGA
GenBank Accession AL949720 [GenBank]
Graphic View Graphic view of sequence AL949720 of line 322H06
Predicted Position of Insertion Chr4:17406853 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) AP22
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At2g31660

 
Sequence (A. th genome BLAST matches underlined)
>48-K015946-022-322-H06-8409
CCTCCCTATAGATGAGACTTTATGTAAAAACCATCTTAAAGTGTCTGGATGGAATGGAAA
ACACATTGAAGGTTGGAGAGGCTGAAAAGAACTGCAGGAGACGACGTGAGCTGGTATACT
CGACTGATCGAAGCGGAAGGGCTATGGGATCCTGCCTATAGTGAGAATTCTATTGTTCGC
TTTGATAGCTGATAAAGGGGTTGTTACTCTCTTGGTACCAGGGAACATGATAAAAAGGTT
TGCTGCTTGGGTTTGACTTCATTACTTGCTCTCCCTGGGGGTCAATTCCCCGATGAAGCG
CTGCAGCGTGTTTTCAGGGCAACACTTGATCTTCTATGGGATCCTCCTTATAGTGAG
GenBank Accession BX890978 [GenBank]
Graphic View Graphic view of gene At2g31660
Predicted Position of Insertion Chr2:13470254 - go to primer design
BLAST e Value 7e-92
Hit Clone Code (BAC ID) T9H9
Hit Gene Code At2g31660 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARM repeat superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03