Sequences from confirmation amplicon


Confirmation sequences for line 324B11 and hit At2g38470 are shown.
Line ID 324B11
Locus At2g38470 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:16108797
Primers used for PCR IS31 - 8474, show primer details
   
Sequence Name 35-K017887-022-324-B11C-IS31
GenBank Accession LN501634 [GenBank]
Sequencing primer gene specific primer, IS31: 5'-TTGTAGTTGTAGTTGTGGTCGGAG-3'
Sequence (A. th genome BLAST matches underlined)
>35-K017887-022-324-B11C-IS31
CTCCTGATGATTGTGTGTGGAATGAGAAATCGAATAAGTTAAAGTTGTTGTTGTTGCTCT
TGTCTCCTTCATTTATACCTTTCTGGTTAGTTACGTTTGTGATTAAAGCTCCTGTGGTTG
GAGAAGCTAGAACCTGCAAAACAATCCCAAGAATTGTTCAGACTTCAAGAAAAGAGACAA
ATAGCAATAACATAATTAAGAAAGAGTCGAGAGTTGACTCTAAAAGTCTTTCTCTCTCTT
TGAAACCGTTGACCCATAACTTTATCACTTCCGATCACGATTCATTGTCAAGATGTTAAA
TCAAGGTCATAATATTTATCAAGATGTATACAATCAAGGTCATAAATCCAGGATATATTC
AATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCA
ATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCC
GCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTA
TTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTC
TACAT
   
Sequence Name 36-K017887-022-324-B11C-8409
GenBank Accession LN502037 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>36-K017887-022-324-B11C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGGATTTATGACCT
TGATTGTATACATCTTGATAAATATTATGACCTTGATTTAACATCTTGACAATGAATCGT
GATCGGAAGTGATAAAGTTATGGGTCAACGGTTTCAAAGAGAGAGAAAGACTTTTAGAGT
CAACTCTCGACTCTTTCTTAATTATGTTATTGCTATTTGTCTCTTTTCTTGAAGTCTGAA
CAATTCTTGGGATTGTTTTGCAGGTTCTAGCTTCTCCAACCACAGGAGCTTTAATCACAA
ACGTAACTAACCAGAAAGGTATAAATGAAGGAGACAAGAGCAACAACAACAACTTTAACT
TATTCGATTTCTCATTCCACACACAATCATCAGGAGTTTCTGCTCCGACCACAACTACAA
CTAC

Last Updated on 07.07.2016 14:16