SimpleSearch - Line and FST details


Line specific information

 
Line ID 324B11
Vector Used pAC161
Line Availability only available from NASC (N431031)
Segregation Analysis 100:100:99
Confirmed for Hit At2g38470
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g38470

Sequence (A. th genome BLAST matches underlined)
>82-K015983-022-324-B11-8409
NTGACATTTAGATTTCCCGGAATGAAGCCATTTACAATTGAATATATCCTGGATTTATGA
CCTTGATTGCATACGTCTTGATACATATTATGACCTTGATTTAACATCTTGACAATGAAT
CGTGATCGGAAGTGATAAAGTTATGGGTCAACGGGTTCAAAGAGAGAGAAAGACTTTTAG
AGTCAACTCTCGACTCTTTCTTAATTATGATATTGCTATTTGTCTCTTTCTCTTGAAGTC
TGAACAATTCTTGGGATTGTTTTGCAGGTCCTATGGGATCCTCCTTATAGCGAGAATATG
TATGCACTTTATTATTATTTTTTTTTAAATGAATGTTAATCCTATGGGATCCTCCCTATA
GTGAG
GenBank Accession BX890980 [GenBank]
Graphic View Graphic view of gene At2g38470
Predicted Position of Insertion Chr2:16108760 - go to primer design
BLAST e Value 3e-84
Hit Clone Code (BAC ID) T19C21
Hit Gene Code At2g38470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 33
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Andreasson et al. 2005, w33]
Other FSTs Supporting this Hit BX890979 [GenBank]


Last Updated on 31.08.2016 09:40