Sequences from confirmation amplicon


Confirmation sequences for line 325E11 and hit At1g09140 are shown.
Line ID 325E11
Locus At1g09140 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:2945601
Primers used for PCR PM01 - 8474, show primer details
   
Sequence Name 33-K021853-022-325-E11C-8409
GenBank Accession LN500821 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>33-K021853-022-325-E11C-8409
CCATTTACATTGAATATATCCTGGGTTATGAACATTGATTTATCCTGTCATTACAATTGT
GGACATTGATTTGAAGATTCCACCGAGACCTCCTGGTTATGCCTTTGTCGAGGTATATTG
ATCAAGTACAAATTTGTTTTTTTCTTCTTCTTGTAATAGTATAGGCTAATGACTAAGATA
GTTTGTTATTGGTGGCAGTTTGAAGATCCTCGTGATGCAGACGATGCAATTTATGGACGT
GATGGTTATGATTTTGATGGGTGTCGACTTCGGGTTAGTAAACGCATGATGAAAGCTAGC
TTAATTTTCTGTAATTTCTTGTAAAGGTGTTATCTTTGTGTGATGTTTTTAGGTTGAGAT
TGCACATGGTGGTCGTAGATTTTCACCATCAGTTGATAGGTACAGCAGCAGCTACAGTGC
GAGCCGTGCACCTTCAAGACGCTCTGACTACCGCGGTTTGTAGAGTCTTCTCGATTGTGT
TATTTGGTGTTGTGTAAAATTTTATATTTGAAAACTCATTTTTACTACCTAAACATGT
   
Sequence Name 34-K021853-022-325-E11C-PM01
GenBank Accession LN501245 [GenBank]
Sequencing primer gene specific primer, PM01: 5'-GGTCACAAGCACTACATGTTTAGG-3'
Sequence (A. th genome BLAST matches underlined)
>34-K021853-022-325-E11C-PM01
AATTTTACCAACACCAATAACACAATCGAGAAGACTCTACAAACCGCGGTAGTCAGAGCG
TCTTGAAGGTGCACGGCTCGCACTGTAGCTGCTGCTGTACCTATCAACTGATGGTGAAAA
TCTACGACCACCATGTGCAATCTCAACCTAAAAACATCACACAAAGATAACACCTTTACA
AGAAATTACAGAAAATTAAGCTAGCTTTCATCATGCGTTTACTAACCCGAAGTCGACACC
CATCAAAATCATAACCATCACGTCCATAAATTGCATCGTCTGCATCACGAGGATCTTCAA
ACTGCCACCAATAACAAACTATCTTAGTCATTAGCCTATACTATTACAAGAAGAAGAAAA
AAACAAATTTGTACTTGATCAATATACCTCGACAAAGGCATAACCAGGAGGTCTCGGTGG
AATCTTCAAATCAATGTCCACAATTGTAATGACAGGATAAATCAATGTTCATAACCAGGA
TATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATG
ATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTA
GATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATC
CGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCG
ACGTGTCTACT

Last Updated on 23.10.2014 13:25