SimpleSearch - Line and FST details


Line specific information

 
Line ID 325E11
Vector Used pAC161
Line Availability only available from NASC (N431163)
Segregation Analysis 100:98:87
Confirmed for Hit At1g09140
Parent of DUPLO pair none
Parent of pair(s) 3499, 3565, 9762

Gene hit T10K17

 
Sequence (A. th genome BLAST matches underlined)
>85-K015984-022-325-E11-8409
AAAAAAATTGGAATTACTCTTTCTCTTTCTCATATTGACCATCATACTCATTCCTGATCC
ATGGAGATTTCCCGGACATGAAGCCCTTTGCCCTTGAACATAATTTTTTCCAATGGGCAA
TAGATTTTATATATGAGATTGTTTTGACCCTCCCTTTAAAAGACAAAAACAAGCCCCGGA
TGAGTTGTTTTTTTTCGCCACGCGAGGTGGCTGCTACCCCACCGGCCCAATTTGAATAAT
TCACAAAAGGCTTGCTTTGCCTTTTTTAAAATTTTGAAAAATAATTCCCTTTATATTTGT
TTATGACCATTTCTAACTTATAAAAAACAAAATTAGGTGTTTGGTCGGAAATCTTGGACC
AATATATCCAACCNGTTTTAAATGAGATTTTTGGCGTAAAAAGATTTCCAAAAAC
GenBank Accession FR807945 [GenBank]
Graphic View Graphic view of sequence FR807945 of line 325E11
Predicted Position of Insertion Chr3:21512036 - go to primer design
BLAST e Value 5e-19
Hit Clone Code (BAC ID) T10K17
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g09140

 
Sequence (A. th genome BLAST matches underlined)
>85-K015977-022-325-E11-8409
TGATCCTGTAATTTCCCGGACATGAAGCCTTTACAATTGAATATATCCTGGTATATGAGC
ATTGATTTATCCTGTCATTACAATTGAGGACATTGATTTGAAGATTCCACCGAGACCTCC
TGGTTATGCCTTTGTCGAGGTATATTGATCAAGTACAAATTTGTTTTTTTCTTCTTCTTG
TAATAGTATAGGCTAATGACTAAGATAGTTTGTTATTGGTGGCAGTTTGAAGATCCTCGT
GATGCAGACGATGCAATTTATGGACGTGATGGTTATGATTTTGATGGGTGTCGACTTCGG
GTTAGTAAACGCATGATGAAAGCTATGGGATCTCCTCTATAGTGAGACANNNNAACTGNN
NNTNNCCNNNTTCTATGTCTATGGGATCCTCCCTATAGTGAGANNNANAAAAAAAAANCC
CCCCGGCGNGGGATCCGCGGAAAAAACCACGTGGGTGGAACCCACAAAACGAAGAAGGAG
GGGCGGGAGGGGGGCGACACGAAGCGGCGAGAAAGTCGGGACAAACGCACGGGAGGGGGN
TGAGAGGAGAAATAGGGAAAAACGACGGAGGGCTACCAACGGGTACACCCCCAGCGCGAT
TCGGCGCACGACGAACGGGGCGGGAGGACGAACGGCGGGCAGTAATGCGAAAACCTGCCA
AAGGCAGGAGAGAACAAGGAAGAC
GenBank Accession AL950061 [GenBank]
Graphic View Graphic view of gene At1g09140
Predicted Position of Insertion Chr1:2945623 - go to primer design
BLAST e Value 4e-121
Hit Clone Code (BAC ID) T12M4
Hit Gene Code At1g09140 [TAIR] [MIPS] [SIGnAL]
Gene Annotation SERINE-ARGININE PROTEIN 30
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23