Sequences from confirmation amplicon


Confirmation sequences for line 327D02 and hit At3g43920 are shown.
Line ID 327D02
Locus At3g43920 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:15754149
Primers used for PCR WA01 - 8474, show primer details
   
Sequence Name 35-K021853-022-327-D02C-8409
GenBank Accession LN501659 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>35-K021853-022-327-D02C-8409
AGCCATTTACATTGAATATAATCTGGGATGAGGAATTTAGCAAGCACGATGTAAGTTTCT
GTTTCTTTTTGTGTATATTTGGCTAGTTATACGCCAACAAAGTGACTTGCTTGTAGTTTT
GGTGATTTTATATCAAAATTTCTTTGTGTGGTTAGTGAAACTTTGGCAGAATGTTGTAAT
CCACTTTGACCAGCTCATTGTTGTATTTTGAGTCATGAATGTTCTCTGAGTTAGTTAAAA
GCCCATTCCAATTTGTTACTTTTGGGGTTGGTTCTTCTTCCAATGCTGATTATTTCTTAA
TTATTTTGTTTGAACTTGTTTGCTTGAGCCCTTGACGTAGATTTGTGACTGCATTGATCT
CACTAACAGAATCACATACTTCTCTTTTGTTGCCGAATCCACGTGAGTCTATTATCTGCA
ATGAAATTATGTTTTGTATGGTTCAGGTTTTAGTTATGACTCCTCAAATATTATTGGATG
T
   
Sequence Name 36-K021853-022-327-D02C-WA01
GenBank Accession LN502057 [GenBank]
Sequencing primer gene specific primer, WA01: 5'-TGCACTTCTAAGGACATCCAATAA-3'
Sequence (A. th genome BLAST matches underlined)
>36-K021853-022-327-D02C-WA01
AACTGACCATAAAAACATAATTTCATTGCAGATAATAGACTCACGTGGATTCGGCAACAA
AAGAGAAGTATGTGATTCTGTTAGTGAGATCAATGCAGTCACAAATCTACGTCAAGGGCT
CAAGCAAACAAGTTCAAACAAAATAATTAAGAAATAATCAGCATTGGAAGAAGAACCAAC
CCCAAAAGTAACAAATTGGAATGGGCTTTTAACTAACTCAGAGAACATTCATGACTCAAA
ATACAACAATGAGCTGGTCAAAGTGGATTACAACATTCTGCCAAAGTTTCACTAACCACA
CAAAGAAATTTTGATATAAAATCACCAAAACTACAAGCAAGTCACTTTGTTGGCGTATAA
CTAGCCAAATATACACAAAAAGAAACAGAAACTTACATCGTGCTTGCTAAATTCCTCATC
CCAGATTATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATG
AGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAA
AATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATT
ACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTT
ATTTCGACGTGTCTACT
Primers used for PCR FN31 - 8474, show primer details
   
Sequence Name 10-K035333-022-327-D02C-FN31
GenBank Accession LN490558 [GenBank]
Sequencing primer gene specific primer, FN31: 5'-GAAAATTCTCTGAAATCGATGGAG-3'
Sequence (A. th genome BLAST matches underlined)
>10-K035333-022-327-D02C-FN31
TTCTCCTATGATGACTGACTCTAATGGGTATCATCATCTTCCTCTCTTTGTACTTGATTT
TGGGTCTTATGGGTTTTTAGTCTTTTTCACTAAAGTTTACTTTTTTTTTGGCAGTAGTTA
TGAATTGAAAGTGTACGAGGTTGCTAAGAACAGGAACATAATTGCTGTTTTGGGGACAGG
GATTGATAAGTCAAAGATCACTAAAAGGCTTATCAAAGCTATGGGTTCTTCTGATACAGA
CAAAAGATTGATAATTTTCTTGGCCCCAACTGTGAATCTTGTTAAACAGGCAAGTCTCTT
GTTTGATTGTAAAAAGAAAAACTGTTTCATTTGGATTTTAATCATTTTGAGTTGATGATG
TTGGCTAATGAGTCGCCTTGGGAGCTTATTTTTGAATGTTTTATTGGTGTGTGTGGTTTT
AGCAATGCTGTGAGATCAGAGCACTTGTGAATTTGAAAGTTGAAGAGTACTTTGGAGCTA
AAGGAGTTGATAAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGA
GTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAA
ATGTAAATGTCCCCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTA
CGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTA
TTTCGACGTGTCTA
   
Sequence Name 10-K035333-022-327-D02C-8409
GenBank Accession LN490557 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>10-K035333-022-327-D02C-8409
GAGCCATTTAAATTTATCAACTCCTTTAGCTCCAAAGTACTCTTCAACTTTCAAATTCAC
AAGTGCTCTGATCTCACAGCATTGCTAAAACCACACACACCAATAAAACATTCAAAAATA
AGCTCCCAAGGCGACTCATTAGCCAACATCATCAACTCAAAATGATTAAAATCCAAATGA
AACAGTTTTTCTTTTTACAATCAAACAAGAGACTTGCCTGTTTAACAAGATTCACAGTTG
GGGCCAAGAAAATTATCAATCTTTTGTCTGTATCAGAAGAACCCATAGCTTTGATAAGCC
TCTTAGTGATCTCTGACTTATCAATCCCTGTCCCCAAAACAGCAATTATGTTCCTGTTCT
TAGCAACCTCGTACACTTTCAATTCATAACTACTGCCAAAAAAAAAGTAAACTTTAGTGA
AAAAGACTAAAAACCCATAAAACCCAAAATCAAGTACAAAGAGAGGAAGATGATGATACC
CATTAAAGTCAGTCATCATAGGAAAAGAGACAGAATCAAGATTTTGATCTCCATCGATTT
CAAAAAATT

Last Updated on 23.10.2014 13:25