SimpleSearch - Line and FST details


Line specific information

 
Line ID 327D02
Vector Used pAC161
Line Availability only available from NASC (N431334)
Segregation Analysis 100:100:71
Confirmed for Hit At3g43920
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g43920

Sequence (A. th genome BLAST matches underlined)
>10-K035333-022-327-D02C-8409
GAGCCATTTAAATTTATCAACTCCTTTAGCTCCAAAGTACTCTTCAACTTTCAAATTCAC
AAGTGCTCTGATCTCACAGCATTGCTAAAACCACACACACCAATAAAACATTCAAAAATA
AGCTCCCAAGGCGACTCATTAGCCAACATCATCAACTCAAAATGATTAAAATCCAAATGA
AACAGTTTTTCTTTTTACAATCAAACAAGAGACTTGCCTGTTTAACAAGATTCACAGTTG
GGGCCAAGAAAATTATCAATCTTTTGTCTGTATCAGAAGAACCCATAGCTTTGATAAGCC
TCTTAGTGATCTCTGACTTATCAATCCCTGTCCCCAAAACAGCAATTATGTTCCTGTTCT
TAGCAACCTCGTACACTTTCAATTCATAACTACTGCCAAAAAAAAAGTAAACTTTAGTGA
AAAAGACTAAAAACCCATAAAACCCAAAATCAAGTACAAAGAGAGGAAGATGATGATACC
CATTAAAGTCAGTCATCATAGGAAAAGAGACAGAATCAAGATTTTGATCTCCATCGATTT
CAAAAAATT
GenBank Accession HG968899 [GenBank]
Graphic View Graphic view of gene At3g43920
Predicted Position of Insertion Chr3:15754149 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T15B3
Hit Gene Code At3g43920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation dicer-like 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Daxinger et al. 2008, dcl3-4]


Last Updated on 07.07.2016 14:03