Sequences from confirmation amplicon


Confirmation sequences for line 329F04 and hit At2g35530 are shown.
Line ID 329F04
Locus At2g35530 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:14922984
Primers used for PCR DR11 - 8474, show primer details
   
Sequence Name 28-K018976-022-329-F04C-DR11
GenBank Accession LN498647 [GenBank]
Sequencing primer gene specific primer, DR11: 5'-TGTTGAACGAAGAAAACACAAATC-3'
Sequence (A. th genome BLAST matches underlined)
>28-K018976-022-329-F04C-DR11
AGAAATCAACAAGCTCAAAAGCCAATGCGAAGAGCTTACCACCGAGAACACCTCTCTCAA
GGTAAAAAAAAAGTAATCTTTCAAAATTAGTTTTAGAGCCAGCCAACGAAACAGTTACCA
ACTTTGTTCTTGCAGGACCAACTTTCATTATTCCCTCCACTTGAAGGCATAAGCATGGAC
AATGACCACCAAGAACCAGACACCAATCAAACAGGTGCCGCAGAGAGAAAGGTTGATTCA
TACAAAGACTCAACGTGAGAAGACATAGAGCAAAACCAATTCCTAACACAGGTATAAAAA
AGTAGCAGCAGCAGCAACAACAACACTCGGCGGTTCTTTGCTAACAGATGGTTTGTAGGA
TTTTAGGCATCAAAGATCGATTGGTTCCGAATAGTTTATTGAGGGTTGTTGGTCCAGTGT
ATGTGTGTGTAAGTTACGAAATTAGATATTGGGAGAAAAAATTCCCTCGTTTAATGTTTT
ACTTTGCCTTTGCTCTACTTGCAGAAGCGAATCTGAGGCAATGTGCTTATCTGTATCAAA
ATTGTTACCATTTTGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGG
ATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTT
TCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAA
ACGACAAA
   
Sequence Name 32-K018976-022-329-F04C-8409
GenBank Accession LN500386 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>32-K018976-022-329-F04C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCAAAATGGTAACAATT
TTGATACAGATAAGCACATTGCCTCAGATTCGCTTCTGCAAGTAGAGCAAAGGCAAAGTA
AAACATTAAACGAGGGAATTTTTTCTCCCAATATCTAATTTCGTAACTTACACACACATA
CACTGGACCAACAACCCTCAATAAACTATTCGGAACCAATCGATCTCTGATGCCTAAAAT
CCTACAAACCATCTGTTAGCAAAGAACCGCCGAGTGTTGTTGTTGCTGCTGCTGCTACTT
TTTTATACCTGTGTTAGGAATTGGTTTTGCTCTATGTCTTCTCACGTTGAGTCTTTGTAT
GAATCAACCTTTCTCTCTGCGGCACCTGTTTGATTGGTGTCTGGTTCTTGGTGGTCATTG
TCCATGCTTATGCCTTCAAGTGGAGGGAATAATGAAAGTTGGTCCTGCAAGAACAAAGTT
GGTAACTGTTTCGTTGGCTGGCTCTAAAACTAATTTTGAAAGATTACTTTTTTTTTACCT
TGAGAGAGGTGTTCTCGGTGGTAAGCTCTTCGCATTGGCTTTTGAGCTTGTTGATTTCTG
CTCTGAGATTTGT

Last Updated on 07.07.2016 14:16