SimpleSearch - Line and FST details


Line specific information

 
Line ID 329F04
Vector Used pAC161
Line Availability only available from NASC (N431552)
Segregation Analysis 100:99:72
Confirmed for Hit At2g35530
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g35530

 
Sequence (A. th genome BLAST matches underlined)
>30-K016035-022-329-F04-8409
AGTCGCTGATGCCATTAGAGCTTAGGGACCATAAAATCGTAACCCGAGGGAAATTTTTCT
CTCGGAAATCTAACTACAGAACGTACACACACATACACTGGACCAACAACCCTCAATAAA
CTATTCGGAACCAATCGATCTCTGATGCCTAAAATCCTACAAACCATCTGTTAGCAAAGA
ACCGCCGAGTGTTGTTGTTGCTGCTGCTGCTACTTTTTTATACCTGTGTTAGGAATTGGT
TTTGCTCTATGTCTTCTCACGTTGAGTCTTTGTATGAATCAACCTTTCTCTCTGCGGCAC
CTGATTGATTGGTGTCTAGGTTCTTGGTGGTCATTGTCCATGCTTATGCCTTCAAGTGGA
GGGAATAATGAAAGTTGGTCCTGCAAGAACAAAGTTGGTAACTGTTTCGTTGGCTGGCTC
TAAAACTATTTTTGAAAGATTACTTTTTTTTTACCTTGAGAGAGGTGTTCTCGGTGGTAA
GCTCTTCGCATTGGCTTTTGAGCTTGTTGATTTCTGCTCTGAGATTTGTGTTTTCTTCGT
TCAACACCTCAGCGCGTTGGGCCAGCTCATCACATTCGGCCTAAATCACAAACACCGGGT
CAATAATTTGCTCACATGGGCGTGCTATG
GenBank Accession AL950581 [GenBank]
Graphic View Graphic view of gene At2g35530
Predicted Position of Insertion Chr2:14922996 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T32F12
Hit Gene Code At2g35530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic region/leucine zipper transcription factor 16
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL950582 [GenBank]


Last Updated on 31.08.2016 09:40