Sequences from confirmation amplicon


Confirmation sequences for line 330F08 and hit At5g65550 are shown.
Line ID 330F08
Locus At5g65550 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:26199707
Primers used for PCR PE54 - 8474, show primer details
   
Sequence Name 15-K022564-022-330-F08C-8409
GenBank Accession LN492781 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K022564-022-330-F08C-8409
GCCATACTGTGTCCTTCATCTCCACAGCTCGTAACATTTCACGTCTTCCCAATATATCCT
CCGACCTTTCCGTGAATTTCGTTTCTTTGCCGTTAAGTCAAACCGTCGACCATCTCCCAG
AGAACGCTGAGGCCACCACTGATGTCCCGGAGACTCACATAGCTTATCTGAAGAAAGCAT
TTGATGGGCTTTCTGAAGCTTTCACAGAGTTTTTAGAAGCTTCCAAACCAAACTGGATAG
TGTATGATATCTTGCACCATTGGGTCCCGCCTATCGCTGAGAAGCTCGGCGTGAGACGAG
CCATCTTCTGCACGTTCAACGCAGCTTCCATCATCATCATCGGTGGGCCAGCATCAGTCA
TGATTCAAGGTCATGACCCTCGAAAGACTGCTGAAGATCTTATCGTGCCTCCACCATGGG
TCCCGTTTGAGACCAACATAGTTTACCGTCTCTTTGAAGCTAAGAGGATCATGGAGTATC
CCACGGCAGGTGTAACTGGAGTTGAATTGAACGACAACTGTAGATTGGGTTTGGCTTACG
TTGGCTCTGAGGTTATTGTGATTAGATCATGTATGGAACTCGAACCTGATGGATTCAATT
GCTCAGTAAACTCCAAGGAAAGCCTGTGATTCCAATTGGTTTACTCCCGGCTACACCAAT
GGATGATGCAGATGACGAGGGAACATGGTTAGACATCAGAGAATGGCTAGACAGACATCA
AGCAAAGTCTGTGGTTTATGTAGCC
   
Sequence Name 16-K022564-022-330-F08C-PE54
GenBank Accession LN493251 [GenBank]
Sequencing primer gene specific primer, PE54: 5'-CCCATCAGGTAGTAGCATAGAAGC-3'
Sequence (A. th genome BLAST matches underlined)
>16-K022564-022-330-F08C-PE54
CTAGTCCTCTTCCTTAGCGTCCAAAAGAAAGGTAACCTGCAAAGCTCCAACCCATGAGCT
AAACCTTGAATCTCTTCGTTACTAATTGTCACTTCAGTTCCTAAGGCTACATAAACCACA
GACTTTGCTTGATGTCTGTCTAGCCATTCTCTGATGTCTAACCATGTTCCCTCGTCATCT
GCATCATCCATTGGTGTAGCCGGGAGTAAACCAATTGGAATCACAGGCTTTCCTTGGAGT
TTACTGAGCAATTGAATCCACTCAGGTTCGAGTTCCATACATGATCTAATCACAATAACC
TCAGAGCCAACGTAAGCCAAACCCAATCTACAGTTGTCGTTCAATTCAACTCCAGTTACA
CCTGCCGTGGGATACTCCATGATCCTCTTAGCTTCAAAGAGACGGTAAACTATGTTGGTC
TCAAACGGGACCCATGGTGGAGGCACGATAAGATCTTCAGCAGTCTTTCGAGGGTCATGA
CCTTGAATCATGACTGATGCTGGCCCACCGATGATGATGATGGAAGCTGCGTTGAACGTG
CAGAAGATGGCTCGTCTCACGCCGAGCTTCTCAGCGATAGGCGGGACCCAATGGTGCAAG
ATATCATACACTATCCAGTTTGGTTTGGAAGCTTCTAAAAACTCTGTGAAAGCTTCAGAA
AGCCCATCAAATGCTTTCTTCAGATAAGCTATGTGAGTCTCCGGGACATCAGTGGTGGCC
TCAGCGTTCTC

Last Updated on 23.10.2014 13:25