SimpleSearch - Line and FST details


Line specific information

 
Line ID 330F08
Vector Used pAC161
Line Availability only available from NASC (N431652)
Segregation Analysis 100:99:97
Confirmed for Hit At5g65550
Parent of DUPLO pair none
Parent of pair(s) 2785, 97566

Gene hit F25I24

 
Sequence (A. th genome BLAST matches underlined)
>62-K016045-022-330-F08-8409
CGAGGAAGATGTCCAAATTAGAGTTTCTGATTACTCTACTAGGTGACTTGTATGACAACT
ACACTCCCATTTTATAATCATACTCGCCTCCCAGGTGAGCGAAGGACACCTTCTTCCCAA
GCTTACAGGCTCCTTATGAGATCTATAGTCTATGCAACTCAATCCTCTTCCACCAAATTA
GTGATGCATCGTACAAGATATTATCTCTTGAGCCCTCACTGTACATACTGCATGACAACG
TAGAAGAGCCTCTAGAGACTGCTGAATACCACTTTTCGACTCCCTGCTGATATTAGTTTA
AATTCAATCTAACAAATCGTGCCTTCAAAAATCTGAAGAACATGTCTTTTTATTCTTAAC
GCCGGTGGGACCATAGACGAAATCAACAATGTTGAAGGTTGGAGGCGGATTTGGCCGACT
TTGTTTTTGATGGGAGTTCGTGAATGGCCTTCAAAACTGCAATGGGTTCAGTTGATCTCT
GenBank Accession FR808041 [GenBank]
Graphic View Graphic view of sequence FR808041 of line 330F08
Predicted Position of Insertion Chr4:6672501 - go to primer design
BLAST e Value 2e-30
Hit Clone Code (BAC ID) F25I24
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At5g65550

 
Sequence (A. th genome BLAST matches underlined)
>62-K016036-022-330-F08-8409
TATATCCTCCGACCTTTCCGTGAATTTGCTTTCTTTGCCGATAAGACAAACCGTCTACCA
TCTCCCATAGAACGCTGAGGCCACCACTGATGTGCCGGATACTCACATAGCTTATCTGAA
GACAGCATTTGATGGGCTTTCTGAAGCTTTCACTGAGTTTTTAGAAGCTTCCTAACCTCA
CTGGATAGTGTATGATATCTTGCTCCATTGCGTCCCGCCTATCGCTGAGATAGCTCGGGG
TGAGACGAGCCATCTTCGTGCACGTTCGACGCAGCTTCCATCATCGTCCTCTGGGGGTCA
ACGTCATCCTGCATTTCAAGGACATGACCCTCGAAAGACTGCTGAAGATCTTATCGTGCC
TCCACCATGGGTCCCGTTTGAGACCAACATAGTTTACCGTCTCTTTGAAGCTAAGAGGAT
CATGGAGTATCCCACGGCAGGTGTAACTGGAGTTGAATTGAACGACAACTGTAGATTGGG
TTTGGCTTACGTTGGCTCTGAGGTTATTGTGATTAGATCATGTATGGAACTCGAACCTGA
GTGGATTCAATTGCTCAGTAAACTCCAAGGAAAGCCTGTGATTCCAATTGGTTTACTCCC
GGCTACACCAATGGATGATGCAGATGACGAGGGAAACATGGTTAGACATCAGAGAATGGC
TATG
GenBank Accession AL950706 [GenBank]
Graphic View Graphic view of gene At5g65550
Predicted Position of Insertion Chr5:26199655 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) K21L13
Hit Gene Code At5g65550 [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-Glycosyltransferase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23