Sequences from confirmation amplicon


Confirmation sequences for line 330G02 and hit At2g47460 are shown.
Line ID 330G02
Locus At2g47460 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:19479414
Primers used for PCR FM01 - 8474, show primer details
   
Sequence Name 39-K017390-022-330-G02C-FM01
GenBank Accession LN503180 [GenBank]
Sequencing primer gene specific primer, FM01: 5'-GAGTTTATCGATTGGGATTGTGTT-3'
Sequence (A. th genome BLAST matches underlined)
>39-K017390-022-330-G02C-fm01
GTAGTGATAATAATCTTTGGCATGAGAAAGAGAATCCCGACTCAATGGTCTCGTGGCTTT
TAGACGGTGATGATGAGGCCACGATCGGGAATAGTAATTGTGAGAACTTTGGAGAACCGT
TAGATCATGACGACGAAAGCGCTTTGGTCGCTTGGCTTCTGTCATGATGATATTGATTGA
TCCGTTATGTAATCTTTTTTGTGCATTCACAGTTTGAATCTATTCCACGTCGTATCATAT
CATAAAGTTTAGGATCTAAATATTAGTCCATTAGTTAAAATTATCTAATGCAATAAAACC
CATGGGATGTTTGGATTGTACGTAAGGTTAAAATATTGCTTCCCGGAAACCTACATGTAG
ATTGCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGA
   
Sequence Name 40-K017390-022-330-G02C-8409
GenBank Accession LN503542 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>40-K017390-022-330-G02C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGCAATCTACATGTAGG
TTTCCGGGAAGCAATATTTTAACCTTACGTACAATCCAAACATCCCATGGGTTTTATTGC
ATTAGATAATTTTAACTAATGGACTAATATTTAGATCCTAAACTTTATGATATGATACGA
CGTGGAATAGATTCAAACTGTGAATGCACAAAAAAGATTACATAACGGATCAATCAATAT
CATCATGACAGAAGCCAAGCGACCAAAGCGCTTTCGTCGTCATGATCTAACGGTTCTCCA
AAGTTCTCACAATTACTATTCCCGATCGTGGCCTCATCATCACCGTCTA

Last Updated on 23.10.2014 13:25