SimpleSearch - Line and FST details


Line specific information

 
Line ID 330G02
Vector Used pAC161
Line Availability only available from NASC (N431658)
Segregation Analysis 100:99:83
Confirmed for Hit At2g47460
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit MSJ1

 
Sequence (A. th genome BLAST matches underlined)
>15-K016036-022-330-G02-8409
TGATCTGTAATTTCCCGGACATGAAGCCATTTACATTGAATATATCCTGCCTGCCGCTGC
CGATTTGCTCTCAGAGTAGCTTGCTTGTTGGTTTGTACTCAAAACGGATCTCGCGGTACG
CACATTATGTATGCATTGTGACCTGCACCATGTGCCCCTCCTAAGAGATTGGAATTCGAC
CTCATATACCCACATCTATATTAATCCTTACACACTCATTAATTGTGATCGACTTGTTTT
TTGTATGAATATATATCGCGATTGTTATGCTTCGGCTATGAGATATATCCATATAACGAG
GGAGTTGGCTATGGGATCCTCCCCTTATAGTGAGANNNANAAACNANTGCATTGCATGTT
TGTCTATGGGATCCTCCCTATATTGAGANGAACCACCTTCGTTTTCCACTATCTTCCCAA
TAAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCGAATATTACCCTTTGGT
GAAAACCCTCCCTTAGCCTTTGGTCTTCTGAAAATGGATCTCTGAAATTTTTGCAGTAGA
CAACGGAGTCGTGCTCCACCATGTTAACGACCAATTTCTTCTCGCCCTTGACTCTTAAGA
AACTCT
GenBank Accession FR808043 [GenBank]
Graphic View Graphic view of sequence FR808043 of line 330G02
Predicted Position of Insertion Chr5:25701050 - go to primer design
BLAST e Value 4e-07
Hit Clone Code (BAC ID) MSJ1
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At2g47460

 
Sequence (A. th genome BLAST matches underlined)
>15-K016045-022-330-G02-8409
TGATCTGAAATTTCCCGGACTGAAGCCTTTACATTGAATATATCCTGCACACCTATATCG
TCGATGCCGGACAGGTTAGTGTTACCAAGAGTAGACTCCGAACGTATGCATGGGGATGAT
CGCGTGTAGATATTTATAACTATGGGACTCTCATCTTAGATGCGAAACTTTATGATATGA
TACGACGTGGAATAGATTCAAACTGTGAATGCACAAAAAAGATTACATAACGGATCAATC
AATATCATCATGACAGAAGCCAAGCGACCAAAGCGCTTTCGTCGTCATGATCTAACGGTT
CTCCAAAGTTCTCACAATTACTATTCCCGATCGTGGCCTCATCATCACCGTCTAAAAGCC
ACGAGACCATTGAGTCGGGATTCTCTTTCTCATGCCAAAGATTATTATCACTACCTTCTT
GCCAAACACAATCCCAATCGATAAACTCATCCGTCGACGCATCGTTAACTTGGTGGTCGT
AGTTGAGAAACGACTCCACCGATGGACAAGACTGAAGAAGACAGTCGAGATTCCCTTGGT
TCCAAGTATCCGAGAACCCTCTGGCTCCTTCAGAGTCTCTTATNGTATGCAACTCCCCAT
CACCACCGCACGTTGTGTTTGTGTACAAGTGGCCAGGATCTGACTCGTCCAACAAAAGAT
CGATGATATCATCATCAAACGTTAAAACTCCATTATCGCCAATAATGCTCATGAGATTTT
TTGTACAATCATCTCCATAGTAGTCACATGGTCGTCCTA
GenBank Accession BX285311 [GenBank]
Graphic View Graphic view of gene At2g47460
Predicted Position of Insertion Chr2:19479431 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T30B22
Hit Gene Code At2g47460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 12
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03