Sequences from confirmation amplicon


Confirmation sequences for line 335H09 and hit At5g11390 are shown.
Line ID 335H09
Locus At5g11390 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:3635975
Primers used for PCR BG15 - 8474, show primer details
   
Sequence Name 94-K101673-0022-335-H09C-8409
GenBank Accession LN515296 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>94-K101673-0022-335-H09C-8409
CCATTTACAATTGACAGGTTAGTTATCTGCAAATAAGTCACTATATCTAAGAATCCACTG
TGATGATGATGAAGCTACAAGGACATGAACTAACAGCGAACTGGGGTTTTACGAATATGG
TAATACCTGTTTATGAAGTCGTTCTCGTTCAGCAGCTAGTTGCATGACCAGTTTTTTCAT
GATCTTGTTATGTACCCCGATATCTTTGGCGGTTCGCAATTTTCTTTCTTCTGCTTGCTG
TAAATATTTCTCCCCTTCTTTCAATCTACCCTTAAAGAATTTCAGTTCTTCGTTGACCTC
TGCGTTAGACTCAGATACCATGATCAACTTCTCTTCGGTAATGTCGGCCCTGTTTTCAGC
CTTCAAAACTTTTGATTTTAGATCCTCGATCACATCCTCCATATCAGAAACAGTAGAATA
TAACAAGTTCTGCTTTTCTTTACTTGCTTCAACAGCTGCAACTGCATGTTCTAGTTGTAG
ATCTGAGTCCCTCAAGTGTTTCTCAAGCGATGCTAACTTATGTATAGTGAAGCCCTTGTC
TCTGAAATTCCCCAACTCGTCTTGAAGCTCCTTTTTGCTTTCTTCTAGGATT
   
Sequence Name 94-K101680-0022-335-H09C-BG15
GenBank Accession LN515297 [GenBank]
Sequencing primer gene specific primer, BG15: 5'-ATCCAAGTGCAAAATCCTAGAAGA-3'
Sequence (A. th genome BLAST matches underlined)
>94-K101680-0022-335-H09C-BG15
TTGGGGATTTAGAGAAAGGGCTTCACTATACATAAGTTAGCATCGCTTGAGAAACACTTG
AGGGACTCAGATCTACAACTAGAACATGCAGTTGCAGCTGTTGAAGCAAGTAAAGAAAAG
CAGAACTTGTTATATTCTACTGTTTCTGATATGGAGGATGTGATCGAGGATCTAAAATCA
AAAGTTTTGAAGGCTGAAAACAGGGCCGACATTACCGAAGAGAAGTTGATCATGGTATCT
GAGTCTAACGCAGAGGTCAACGAAGAACTGAAATTCTTTAAGGGTAGATTGAAAGAAGGG
GAGAAATATTTACAGCAAGCAGAAGAAAGAAAATTGCGAACCGCCAAAGATATCGGGGTA
CATAACAAGATCATGAAAAAACTGGTCATGCAACTAGCTGCTGAACGAGAACGACTTCAT
AAACAGGTATTACCATATTCGTAAAACCCCAGTTCGCTGTTAGTTCATGTCCTTGTAGCT
TCATCATCATCACAGTGGATTCTTAGATATAGTGACTTATTTGCAGATAACTAACCTGTC
AATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCA
ATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCC

Last Updated on 07.07.2016 14:16