SimpleSearch - Line and FST details


Line specific information

 
Line ID 335H09
Vector Used pAC161
Line Availability only available from NASC (N432157)
Segregation Analysis 50:43:32
Confirmed for Hit At5g11390
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F14M4

 
Sequence (A. th genome BLAST matches underlined)
>72-K016067-022-335-H09-8409
GATATCTTATATGTCACCGAATGACGTCGGAATCGTTATTGGTTCGATAAGATTCATTAG
ATTCTAGAAATGGCGCAGAAAAAGTAATGCGAGACCATTGCTTCGCTGGCTCCCTGGAAT
AAAGAAAGGTCCCTTTCTCTGTACCTGTGACTTGTTCTTTGTTCTTCATTTTGAATCGAT
AATTTAAAATTCGGACGTGTGTCTTGCTCGTAAAGTAAAATAAGCTTCACGTGGTTCCAA
CCTATGGGATCCTCNCCTATAGTGAGANNNNNCCNGNCNNNANANTNNNNNAACTTTTCN
AGATCCACGAATGTACCTGATCTTACCCATACCCATACCNGCGCCAAAACCAGCATTTCC
GTTCCCTACGATGCATCACGCACCGGTCCGAGCCACATTG
GenBank Accession AL951397 [GenBank]
Graphic View Graphic view of sequence AL951397 of line 335H09
Predicted Position of Insertion Chr2:19316454 - go to primer design
BLAST e Value 1e-77
Hit Clone Code (BAC ID) F14M4
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At5g11390

 
Sequence (A. th genome BLAST matches underlined)
>72-K016062-022-335-H09-8409
TATCCTGTAGATTTCCCGGACATGAAGCCATTTACAATTGACAGGTTAGTTATCTGCAAA
TAAGTCACTATATCTAAGAATCCACTGTGATGATGATGAAGCTACAAGGACATGAACTAA
CAGCGAACTGGGGTTTTACGAATATGGTAATACCTGTTTATGAAGTCGTTCTCGTTCAGC
AGCTATGGGATCCTCCCCTATAGTGAG
GenBank Accession AL951396 [GenBank]
Graphic View Graphic view of gene At5g11390
Predicted Position of Insertion Chr5:3635975 - go to primer design
BLAST e Value 4e-78
Hit Clone Code (BAC ID) F2I11
Hit Gene Code At5g11390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WPP domain-interacting protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03