Sequences from confirmation amplicon


Confirmation sequences for line 337E10 and hit At1g66470 are shown.
Line ID 337E10
Locus At1g66470 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:24796462
Primers used for PCR PH72 - 8474, show primer details
   
Sequence Name 17-K017550-022-337-E10C-PH72
GenBank Accession LN493659 [GenBank]
Sequencing primer gene specific primer, PH72: 5'-CTAAAGATCCACAAAGCCTAGCAG-3'
Sequence (A. th genome BLAST matches underlined)
>17-K017550-022-337-E10C-PH72
TTGCTTTCTTGACATTAATTTACATTCATTAAAATAAAACTCAATCTCTCAACACATATT
TACATATGTTTTATTTTGTTCAGAATCGAAGAGAAAGGATAAGTGAACGTCTCAAGATAT
TGCAAGAACTTGTTCCCAATGGCACCAAGGTACACATCCATATAACCATTTATGACAGAT
TTATTATATTACTTATTCTCATGATAATAATATTTGTTATGTTTCACAGGTTGATTTGGT
GACAATGCTTGAAAAGGCTATTAGTTATGTCAAGTTCCTTCAAGTACAAGTTAAGGTATA
TTAGTTATGACAAACATCCCTCAAATTAATTTTCAGGATTGATTTAATTACCATATTTAT
CGAATTATTACGTAACACGTATTGATATAATCTATTGTTTGAGTATGATATATTCAATTG
TAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATG
GAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGC
GTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTAT
AGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACAT
   
Sequence Name 18-K017550-022-337-E10C-8409
GenBank Accession LN494102 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>18-K017550-022-337-E10C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCATACTCAAACAATAGATTA
TATCAATACGTGTTACGTAATAATTCGATAAATATGGTAATTAAATCAATCCTGAAAATT
AATTTGAGGGATGTTTGTCATAACTAATATACCTTAACTTGTACTTGAAGGAACTTGACA
TAACTAATAGCCTTTTCAAGCATTGTCACCAAATCAACCTGTGAAACATAACAAATATTA
TTATCATGAGAATAAGTAATATAATAAATCTGTCATAAATGGTTATATGGATGTGTACCT
TGGTGCCATTGGGAACAAGTTCTTGCAATATCTTGAGACGTTCACTTATCCTTTCTCTTC
GATTCTGAACAAAATAAAACATATGTAAATATGTGTTGAGAGATTGAGTTTTATTTTAAT
GAATGTAAATTAATGTCAAGAAAGCAAACCTTGGCTGCTAGGCTTTGTG

Last Updated on 07.07.2016 14:16