SimpleSearch - Line and FST details


Line specific information

 
Line ID 337E10
Vector Used pAC161
Line Availability only available from NASC (N432314)
Segregation Analysis 50:50:50
Confirmed for Hit At1g66470
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g66470

 
Sequence (A. th genome BLAST matches underlined)
>77-K016158-022-337-E10-8409
TGATCCTGAAATTTCCCGGACATGAAGCCTTTACAATTGAATATATATTGCGGACCAAGA
GATTCTATTGGATCCTCCCTATAGAGAGATTCAAGAAATATGAGCAATTACATCCATCCT
GTAGAAATAATTCCAGGGATGAGTGTCATAACTAATATACCTTAACTTGTACTTGAAGGA
ACTTGACATAACTAATAGCCTTTTCAAGCATTGTCACCAAATCAACCTGTGAAACATAAC
AAATATTATTATCATGAGAATAAGTAATATAATAAATCTGTCATAAATGGTTATATGGAT
GTGTACCTTGGTGCCATTGGGAACAAGTTCTTGCAATATCTTGAGACGTTCACTTATCCT
TTCTCTTCGATTCTGAACAAAATAAAACATATGTAAATATGTGTTGAGAGATTGAGTTTT
ATTTTAATGAATGTAAATTAATGTCAAGAAAGCAAACCTTGGCTGCTATGGGATC
GenBank Accession AL951628 [GenBank]
Graphic View Graphic view of gene At1g66470
Predicted Position of Insertion Chr1:24796458 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F28G11
Hit Gene Code At1g66470 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ROOT HAIR DEFECTIVE6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23