Sequences from confirmation amplicon


Confirmation sequences for line 341D03 and hit At5g61350 are shown.
Line ID 341D03
Locus At5g61350 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:24669394
Primers used for PCR JK39 - 8474, show primer details
   
Sequence Name 05-K100994-0022-341-D03C-8409
GenBank Accession LN488279 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>05-K100994-0022-341-D03C-8409
CGGACTGAGCCATTTACATTGAATAATTTGTTTTTTGGACTCGAGTGACTTGCGTGTAAA
GGAAGCAACCATGACGAGAAACTATTCTGTTTTTGCCAGTCTTTAGGACGTCTCTGCCAT
CTAACAAGCAACACGACAACCCCTAAGAAAGCGGTTAGCGCCATCACAAACCCAATACCC
GCAATAGCAAGCTTCTTAGATGACATACCACCGATCGGTCCTTTGTATTTCCCATCAACT
CCAAAAAGTCCATCTAAACTCCCAGCAGCATTGTTCAGCTTCATGATCTCTAAACCGTTA
AGTATCGCATTCGGTTTACCCGACTGAAGATTCGGAGTCGGACCAACCTGAACCAAGATC
GAACCATTGGTGATCGTAGACGCATTAAGCACGAAATCCGCGTAATACGCTGTACCTAAA
GCGCTGGTTAGTGAGGAGAGGTCAAGTGCAGAGATTGCAGAGAGCTTGTTGATGAAAACA
TTGAAGATAAGGTCGTTAAGCGATTTGCTTACAATGTCACAAAAATGTAACCTAATGAAG
TAATCATGACCAAAATCAACACTCATTCTCCATGAGAGATTGAAATTAGGTTGCGAGGTT
TGTGCATCGGCCATTTCCTCCGCGGTGGCGTAAACCGGATTAGGAGCGATCAACGCCGTA
GCTCCACCGTCTGGATAAGTAATCGTACTAGGATC
   
Sequence Name 05-K100998-0022-341-D03C-JK39
GenBank Accession LN488280 [GenBank]
Sequencing primer gene specific primer, JK39: 5'-CGAGAAATGTCACTGTTGATCCTA-3'
Sequence (A. th genome BLAST matches underlined)
>05-K100998-0022-341-D03C-JK39
GGCGTTGATCGCTCCTAATCCGGTTACGCCACCGCGGAGGAAATGGCCGATGCACAAACC
TCGCAACCTAATTTCAATCTCTCATGGAGAATGAGTGTTGATTTTGGTCATGATTACTTC
ATTAGGTTACATTTTTGTGACATTGTAAGCAAATCGCTTAACGACCTTATCTTCAATGTT
TTCATCAACAAGCTCTCTGCAATCTCTGCACTTGACCTCTCCTCACTAACCAGCGCTTTA
GGTACAGCGTATTACGCGGATTTCGTGCTTAATGCGTCTACGATCACCAATGGTTCGATC
TTGGTTCAGGTTGGTCCGACTCCGAATCTTCAGTCGGGTAAACCGAATGCGATACTTAAC
GGTTTAGAGATCATGAAGCTGAACAATGCTGCTGGGAGTTTAGATGGACTTTTTGGAGTT
GATGGGAAATACAAAGGACCGATCGGTGGTATGTCATCTAAGAAGCTTGCTATTGCGGGT
ATTGGGTTTGTGATGGCGCTAACCGCTTTCTTAGGGGTTGTCGTGTTGCTTGTTAGATGG
CAGAGACGTCCTAAAGACTGGCAAAAACAGAATAGTTTCTCGTCATGGTTGCTTCCTTTA
CACGCAAGTCACTCGAGTCCAAAAAACAAATTATTCAATTGTAAATGGCTTCATGTCCGG
GAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAAT
TACCAATTTTTTTTCAATTCAAAAATGTAGA

Last Updated on 23.10.2014 13:25