SimpleSearch - Line and FST details


Line specific information

 
Line ID 341D03
Vector Used pAC161
Line Availability only available from NASC (N432679)
Segregation Analysis 50:23:16
Confirmed for Hit At5g61350
Parent of DUPLO pair none
Parent of pair(s) 5117, 7473, 10201
Note Although the line exists, the insertion in At1g77950 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g77950

 
Sequence (A. th genome BLAST matches underlined)
>20-K016153-022-341-D03-8409
TTTCCCGGACATGAAGCATATTCGGGTATGACATGAGTCTGAGCCATTTCAGCATTTTTT
TTTTTCGGGGGGGACAGTTTTTGTTAAGGACTTTGGAAAAACTCAAAATTGAGGATGACT
GGGTTCTCCAAATCAACGAACCTCGGTTTATTCCTCATTAATCCTTATAATAAATTGGTT
TCATCTTGTTTATAGGTTTTAAAAAACAAAATCGGCTATGGGATCCTCCCTATAGGGAGA
GGGCGGATCTATGGGATCCTCCCTATATTGAGAGAAAAAAAAGGGCAAGGTCCCCTCCTT
TTTCGAAGAAGACGGGTTAAGGTCCGCCCCCTTATGATAAGAACCCCNACCTTTTTGTAC
CAAGACCGCCCCCTAGGGGGGCGTACACCCGTTAGCCACGAAATCAGCGTGCTACCCTGC
AAATAAAGCGCTGGCCCGCGAGGAGAGGCCAAGTGCAGACATTGCCGAAAGCTGGTCGAT
GAA
GenBank Accession FR808228 [GenBank]
Graphic View Graphic view of gene At1g77950
Predicted Position of Insertion Chr1:29308746 - go to primer design
BLAST e Value 3e-57
Hit Clone Code (BAC ID) F28K19
Hit Gene Code At1g77950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 67
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 340D03

Gene hit At5g61350

 
Sequence (A. th genome BLAST matches underlined)
>20-K016162-022-341-D03-8409
ATTGAATAATTTGTTTTTTGGACTCGAGTGACTTGCGTGTAAAGGAAGCAACCATGACGA
GAAACTATTCTGTTTTTGCCAGTCTTTAGGACGTCTCTGCCATCTAACAAGCAACACGAC
AACCCCTAAGAAAGCGGTTAGCGCCATCACAAACCCAATACCCGCAATAGCAAGCTTCTT
AGATGACATACCACCGATCGGGGCTTTGAATTACCTATCAGCTCCCATGAGTCCATCTAA
ACTCCCAGTAGCATTGTTCTACTCCATGAGCTCTTCACCGTAAAGTATCGCATTCGGTTT
ACCCGACTGAAGATTCGGAGTCGGACCAACCTGAACCAAGATCGAACCATTGGTGATCGT
AGACGCATTAAGCACGAAATCCGCGTAATACGCTGTACCTAAAGCGCTGGTTAGTGAGGA
GAGGTCAAGTGCAGAGATTGCAGAGAGCTTGTTGATGAAAACATTGAAGATAAGGTCGTT
AAGCGATTTGCTTACAATGTCACAAAAATGTAACCTAATGAAGTAATCATGACCAAAATC
AACACTCATTCTCCATGAGAGATTGAAATTAGGTTGCGAGGTTTGTGCATCGGCCATTTC
CTCCGCGGTGGCGTAAACCGGATTAGGAGCGATCAACGCCGTAGCTCCACCGTCTGGATA
ATAATCGCACTATGG
GenBank Accession AL952153 [GenBank]
Graphic View Graphic view of gene At5g61350
Predicted Position of Insertion Chr5:24669394 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MFB13
Hit Gene Code At5g61350 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03