SimpleSearch - Line and FST details


Line specific information

 
Line ID 341D03
Vector Used pAC161
Line Availability only available from NASC (N432679)
Segregation Analysis 50:23:16
Confirmed for Hit At5g61350
Parent of DUPLO pair none
Parent of pair(s) 5117, 7473, 10201

Gene hit At1g77950

 
Sequence (A. th genome BLAST matches underlined)
>20-K016153-022-341-D03-8409
TTTCCCGGACATGAAGCATATTCGGGTATGACATGAGTCTGAGCCATTTCAGCATTTTTT
TTTTTCGGGGGGGACAGTTTTTGTTAAGGACTTTGGAAAAACTCAAAATTGAGGATGACT
GGGTTCTCCAAATCAACGAACCTCGGTTTATTCCTCATTAATCCTTATAATAAATTGGTT
TCATCTTGTTTATAGGTTTTAAAAAACAAAATCGGCTATGGGATCCTCCCTATAGGGAGA
GGGCGGATCTATGGGATCCTCCCTATATTGAGAGAAAAAAAAGGGCAAGGTCCCCTCCTT
TTTCGAAGAAGACGGGTTAAGGTCCGCCCCCTTATGATAAGAACCCCNACCTTTTTGTAC
CAAGACCGCCCCCTAGGGGGGCGTACACCCGTTAGCCACGAAATCAGCGTGCTACCCTGC
AAATAAAGCGCTGGCCCGCGAGGAGAGGCCAAGTGCAGACATTGCCGAAAGCTGGTCGAT
GAA
GenBank Accession FR808228 [GenBank]
Graphic View Graphic view of gene At1g77950
Predicted Position of Insertion Chr1:29308746 - go to primer design
BLAST e Value 3e-57
Hit Clone Code (BAC ID) F28K19
Hit Gene Code At1g77950 [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 67
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At5g61350

 
Sequence (A. th genome BLAST matches underlined)
>20-K016162-022-341-D03-8409
ATTGAATAATTTGTTTTTTGGACTCGAGTGACTTGCGTGTAAAGGAAGCAACCATGACGA
GAAACTATTCTGTTTTTGCCAGTCTTTAGGACGTCTCTGCCATCTAACAAGCAACACGAC
AACCCCTAAGAAAGCGGTTAGCGCCATCACAAACCCAATACCCGCAATAGCAAGCTTCTT
AGATGACATACCACCGATCGGGGCTTTGAATTACCTATCAGCTCCCATGAGTCCATCTAA
ACTCCCAGTAGCATTGTTCTACTCCATGAGCTCTTCACCGTAAAGTATCGCATTCGGTTT
ACCCGACTGAAGATTCGGAGTCGGACCAACCTGAACCAAGATCGAACCATTGGTGATCGT
AGACGCATTAAGCACGAAATCCGCGTAATACGCTGTACCTAAAGCGCTGGTTAGTGAGGA
GAGGTCAAGTGCAGAGATTGCAGAGAGCTTGTTGATGAAAACATTGAAGATAAGGTCGTT
AAGCGATTTGCTTACAATGTCACAAAAATGTAACCTAATGAAGTAATCATGACCAAAATC
AACACTCATTCTCCATGAGAGATTGAAATTAGGTTGCGAGGTTTGTGCATCGGCCATTTC
CTCCGCGGTGGCGTAAACCGGATTAGGAGCGATCAACGCCGTAGCTCCACCGTCTGGATA
ATAATCGCACTATGG
GenBank Accession AL952153 [GenBank]
Graphic View Graphic view of gene At5g61350
Predicted Position of Insertion Chr5:24669394 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MFB13
Hit Gene Code At5g61350 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23