Sequences from confirmation amplicon


Confirmation sequences for line 343E12 and hit At2g20740 are shown.
Line ID 343E12
Locus At2g20740 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:8936125
Primers used for PCR MI24 - 8474, show primer details
   
Sequence Name 15-K024722-0022-343-E12C-8409
GenBank Accession LN492800 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>15-K024722-0022-343-E12C-8409
TTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGTTGTAATTGGTAATTGGATC
CATTTAGGCTTTGGAAGAGACAGTTTTAAGATTCTTGTAAGATTTGTCTTTCAAATTTGA
TGGCACTGGAAATGAGTGACACATCTTGTTGGGGTGAAACTATGTTTTTCCCGTGGAAAG
ATCATAAATTCTGTAAGCTTGAGGTGTCTAGAAGTAGTTAGGCTATGGAAGAGATAGCTT
CAGGATTCTTGTAAGATGGCACTGGAAAGTGGCATATCTTGTTTTTGTGTGAGGGGGAAG
TTATCATTGTTATGAAATATGAAGTATGCCATTGCTGATGAAAATTTCTGAACCAATCTT
CTTATGAGCTTCAGGTTCATTTATTCATTTCTTGGTCTCGGGGCCATTCTCTGTGTTGTC
ACTTGTGCCGGGCACATAGCTGCTGAAACCGTGAATGGATGTTGCCTTTACTTGGTAAAC
TTCTGTTTTTTTTATAAGTTGTTCCTGCAACTCTATTGATGAATTGTAGCATCACTCACG
TTAGCCCTGTTTTTCTTTG
   
Sequence Name 16-K024722-0022-343-E12C-MI24
GenBank Accession LN493269 [GenBank]
Sequencing primer gene specific primer, MI24: 5'-ACACAAGAAAGAATTCAGGAAGGA-3'
Sequence (A. th genome BLAST matches underlined)
>16-K024722-0022-343-E12C-MI24
GAAACTCCAAAGAAAAACAGGCTAACGTAGTGATGCTACAATTCATCAATAGAGTTGCAG
GAACAACTTATAAAAAAAACAGAAGTTTACCAAGTAAAGGCAACATCCATTCACGGTTTC
AGCAGCTATGTGCCCGGCACAAGTGACAACACAGAGAATGGCCCCGAGACCAAGAAATGA
ATAAATGAACCTGAAGCTCATAAGAAGATTGGTTCAGAAATTTTCATCAGCAATGGCATA
CTTCATATTTCATAACAATGATAACTTCCCCCTCACACAAAAACAAGATATGCCACTTTC
CAGTGCCATCTTACAAGAATCCTGAAGCTATCTCTTCCATAGCCTAACTACTTCTAGACA
CCTCAAGCTTACAGAATTTATGATCTTTCCACGGGAAAAACATAGTTTCACCCCAACAAG
ATGTGTCACTCATTTCCAGTGCCATCAAATTTGAAAGACAAATCTTACAAGAATCTTAAA
ACTGTCTCTTCCAAAGCCTAAATGGATCCAATTACCAATTACAACAGGATATATTCAATT
GTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATAT
GGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAG

Last Updated on 23.10.2014 13:25