Sequences from confirmation amplicon


Confirmation sequences for line 347F02 and hit At3g13662 are shown.
Line ID 347F02
Locus At3g13662 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:4467553
Primers used for PCR NK12 - 8474, show primer details
   
Sequence Name 41-K102592-0022-347-F02C-8409
GenBank Accession LN504035 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>41-K102592-0022-347-F02C-8409
TGAGCATTTACATTGAATCGAAAGATTCCACTACCTCCGACCACCGGCATTTCCCTAACC
TTCGACATCACCACGTTCCGCCCAAGAATCGTTATCGTACTCCCATTGTACTTCCCCGTA
GTGAAAGCAAAGTTCATCACCATCAAGAAGCCTATCTCTCCTTGGGCCGCTGCTACGTAC
ATCCCTTGGGCTTGGCCCACCACAGTCGCATTCCTTGGCACATCGAATGTTAGTGGATCG
TCCATCATGGTGATCGATCCGGATAAGGAAGAGTTCAAGACCGGCTGTTGGATCATCACG
GAGCTAGGGTTTCTACCGTTTACAGAGTTGTGCCAATAGACTCGGAGATGAGTGAGTTTC
TCCTTTTTGTAAGGGCCAAGGTGTTTCCCGTTCATGGTTCTTCCCAATTCATCTCCGACG
GAAGCAACGGCATAGAAAAGGAGGATTTGTGCGGCGAAGATAAGGATGAGGTTAGTCATG
TTGTGGTTTTTGTGTCTCTAGATGAAGGTTTGTGCTATAAATAAACGAGTGTTTTGTGTG
TGTATAAATAGAGATGAAATAAGGCACGTTT
   
Sequence Name 41-K102593-0022-347-F02C-NK12
GenBank Accession LN504036 [GenBank]
Sequencing primer gene specific primer, NK12: 5'-TCTCAAAAGAAAACGTGCCTTATT-3'
Sequence (A. th genome BLAST matches underlined)
>41-K102593-0022-347-F02C-NK12
ACAAAACACTCGTTTATTTATAGCACAAACCTTCATCTAGAGACACAAAAACCACAACAT
GACTAACCTCATCCTTATCTTCGCCGCACAAATCCTCCTTTTCTATGCCGTTGCTTCCGT
CGGAGATGAATTGGGAAGAACCATGAACGGGAAACACCTTGGCCCTTACAAAAAGGAGAA
ACTCACTCATCTCCGAGTCTATTGGCACAACTCTGTAAACGGTAGAAACCCTAGCTCCGT
GATGATCCAACAGCCGGTCTTGAACTCTTCCTTATCCGGATCGATCACCATGATGGACGA
TCCACTAACATTCGATGTGCCAAGGAATGCGACTGTGGTGGGCCAAGCCCAAGGGATGTA
CGTAGCAGCGGCCCAAGGAGAGATAGGCTTCTTGATGGTGATGAACTTTGCTTTCACTAC
GGGGAAGTACAATGGGAGTACGATAACGATTCTTGGGCGGAACGTGGTGATGTCGAAGGT
TAGGGAAATGCCGGTGGTCGGAGGTAGTGGAATCTTTCGATTCAATTGTAAATGGCTTCA
TGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAA
GAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAA
TGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAA
TAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCC

Last Updated on 23.10.2014 13:25