SimpleSearch - Line and FST details


Line specific information

 
Line ID 347F02
Vector Used pAC161
Line Availability only available from NASC (N433278)
Segregation Analysis 50:45:35
Confirmed for Hit At3g13662
Parent of DUPLO pair none
Parent of pair(s) 84820, 84857, 84862

Gene hit At3g13662

 
Sequence (A. th genome BLAST matches underlined)
>14-K016235-022-347-F02-8409
TTTCCCGGACTGAAGCATTTACATTGAATCGAAAGATTCCACTACCTCCGACCACCGGCA
TTTCCCTAACCTTCGACATCACCACGTTCCGCCCAAGAATCGTTATCGTACTCCCATTGT
ACTTCCCCGTAGTGAAAGCAAAGTTCATCACCATCAAGAAGCCTATCTCTCCTTGGGCCG
CTGCTACGTACATCCCTTGGGCTTGGCCCACCACAGTCGCATTCCTTGGCACATCGAATG
TTAGTGGATCGTCCATCATGGTGATCGATCCGGATAAGGAAGAGTTCAAGACCGGCTGTT
GGATCATCACGGAGCTATGGGATCCTCCTTATAGTGAG
GenBank Accession AL952990 [GenBank]
Graphic View Graphic view of gene At3g13662
Predicted Position of Insertion Chr3:4467553 - go to primer design
BLAST e Value 2e-163
Hit Clone Code (BAC ID) MMM17
Hit Gene Code At3g13662 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Disease resistance-responsive (dirigent-like protein) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03