Sequences from confirmation amplicon


Confirmation sequences for line 347G01 and hit At5g41990 are shown.
Line ID 347G01
Locus At5g41990 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:16797002
Primers used for PCR CK73 - 8474, show primer details
   
Sequence Name 33-K026693-022-347-G01C-8409
GenBank Accession LN500849 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>33-K026693-022-347-G01C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATATTAACTCTTGTATAGATA
TAAGGCGTTTGACGAAGTAGACGGGATTGAAGTTGCTTGGAACCTAGTTAGCATTGAAGA
TGTAATGCAGATGCCTGGTCAACTTGAAAGGCTATATTCTGAAGTTCATCTACTAAAGGC
TCTAAAACATGAAAACATCATCAAACTCTTTTACTCTTGGGTTGACGAAAAGAACAAGAC
TATTAACATGATCACTGAGCTTTTCACCTCTGGTAGTCTCAGGGTGTAAGTATCTCCCCC
ACTTCTCTTTTGTATTGATGATCCTTCATTCTTTTTTTTTTTCCTGGGCATCACATGGGT
TGACACCATTTCATTTGATGTGAAGATATCGAAAGAAGCATAGGAAGGTTGATCCCAAGG
CCATCAAGAACTGGGCAAGGCAAATTCTCAAAGGCCTGAACTATTTGCATTCTCAAAACC
CTCCGGTAATTCACCGGGATCTGAAGTGTGACAATATATTTGTCAATGGAAATACTGGAG
AGGTCAAAATCGGAGATCTCGGGCTCGCAACTGTACTGCAGCAGCCCACTGCTCGAAGTG
TGATAGGTAATACACCATA
   
Sequence Name 37-K026693-022-347-G01C-CK73
GenBank Accession LN502480 [GenBank]
Sequencing primer gene specific primer, CK73: 5'-TAGGAAGGAAAATGGTTTATGGTG-3'
Sequence (A. th genome BLAST matches underlined)
>37-K026693-022-347-G01C-CK73
TATTACCTATCACACTTCGAGCAGTGGGCTGCTGCAGTACAGTTGCGAGCCCGAGATCTC
CGATTTTGACCTCTCCAGTATTTCCATTGACAAATATATTGTCACACTTCAGATCCCGGT
GAATTACCGGAGGGTTCTGAGAATGCAAATAGTTCAGGCCTTTGAGAATCTGCCTTGCCC
AGTTCTTGATGGCCTTGGGATCAACCTTCCTATGCTTCTTACGATATCTTCACATCAAAT
GAAATGGTGTCAACCCATGTGATGCACAGGAAAAAAAAAAAGAATGAAGGATCATCAATA
CAAAAGAGAAGTGGGGGAGATACTTACACCCTGAGACTACCAAAGGTGAAAAGCTCAGGG
ATCATGTTAATAGTCTTGTTCTTTTCGCCAACCCAAGAGTAAAAGAGTTTGATGATGTTT
TCATGTTTTAGAGCCTTTAGTAGATGAACTTCAAAATATACCCTTTCAAGTTGACCAGGC
ATCTGCATTACATCTTCAAGGCTAACTAGGTTCCAAGAAATTTCAATCCCGTCTACTTCG
TCAAAC

Last Updated on 23.10.2014 13:25