SimpleSearch - Line and FST details


Line specific information

 
Line ID 347G01
Vector Used pAC161
Line Availability only available from NASC (N433289)
Segregation Analysis 50:49:44
Confirmed for Hit At5g41990
Parent of DUPLO pair none
Parent of pair(s) 3537, 3554, 8311

Gene hit At5g41990

 
Sequence (A. th genome BLAST matches underlined)
>07-K016241-022-347-G01-8409
ATGAGCATTTACATTGAATATATATTAACTCTTGTATAGATATAAGGCGTTTGACGAAGT
AGACGGGATTGAAGTTGCTTGGAACTATGGGATCTTTCATATAGTGAGATAGGCATGACT
ATGGGATCCTCCCTATAGTGAGACAAACNGTATATCTTTCCCCCCTAAAAAAATCAAAAA
ACCCCCCCTTACACCCTGGTCTTACTGATGATTGTTCCAAATGACCAATTGAACCTACCT
CAAAAGTCGAAA
GenBank Accession AL953007 [GenBank]
Graphic View Graphic view of gene At5g41990
Predicted Position of Insertion Chr5:16797002 - go to primer design
BLAST e Value 2e-27
Hit Clone Code (BAC ID) MJC20
Hit Gene Code At5g41990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation with no lysine (K) kinase 8
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40