Sequences from confirmation amplicon


Confirmation sequences for line 347G10 and hit At5g21030 are shown.
Line ID 347G10
Locus At5g21030 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:7143142
Primers used for PCR PH58 - 8474, show primer details
   
Sequence Name 07-K017549-022-347-G10C-PH58
GenBank Accession LN489043 [GenBank]
Sequencing primer gene specific primer, PH58: 5'-AACATTGATACAAGGTAAGCCACC-3'
Sequence (A. th genome BLAST matches underlined)
>07-K017549-022-347-G10C-PH58
GCAGTTCGATTTCACGGATCCTAGTGAAGTAATCGGACACTGTAATCTCAACCTCCTCAA
ATTCCCTGTTTTGGTTCCTTTTCTTCCAAGTAAACCTAAATCACACAAGAAAAAGAGATA
AACGAGAAGCAAAACAAGAAAACTTAAAATAAATATCAACTCACAACATACGTTTGATCT
TTGCAGTGTAGTCCACTTAGTCCGGTTATCTTGTATTCTTGATTTGAAGGGAGGACTTTA
ACTCTAAGATTTTTCAGAGTATTTTTAGCCTATACGAGAGAGAAACAAAAAAAAAAATCA
GAAAATCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAG
CAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAAT
TCAAAAATGTAAATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGAC
AAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAA
TCTTTATTTCGACGTGTCTACATTC
   
Sequence Name 08-K017549-022-347-G10C-8409
GenBank Accession LN489509 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>08-K017549-022-347-G10C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGATTTTCTGATTTTTTT
TTTTGTTTCTCTCTCGTATAGGCTAAAAATACTCTGAAAAATCTTAGAGTTAAAGTCCTC
CCTTCAAATCAAGAATACAAGATAACCGGACTAAGTGGACTACACTGCAAAGATCAAACG
TATGTTGTGAGTTGATATTTATTTTAAGTTTTCTTGTTTTGCT

Last Updated on 23.10.2014 13:25