SimpleSearch - Line and FST details


Line specific information

 
Line ID 347G10
Vector Used pAC161
Line Availability only available from NASC (N433298)
Segregation Analysis 34:33:26
Confirmed for Hit At5g21030
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g21030

 
Sequence (A. th genome BLAST matches underlined)
>79-K016241-022-347-G10-8409
TATCCTGAAATTTCCCGGACATGAAGCCTTTACATTGAATATATCCTGATTTTCTGATTT
TTTTTTTTGTTTCCCCCCCGAAAAGGCTAAAAATACCCTGAAAAATCTTAAAGTTAAAGC
CCCCCCTTCAATTCAAAAATACAAAATACCCGGACTAAGGGGACTACCCTGCAAAAATCA
AACGAATGTGGGGAGTTGATATTAATTTAAAGTTTCCTGGTTTGGCTTCCCGTTAATCCC
TTTTTCTGGGGGGATTAAGGTTTACTGGGAAAAAAAGGAACCAAAACGGGAAATTTGAGG
AGGTTGAAATTACAGGGCCCAATTACTTCCCTAGGGGACCTCCCCCAAAAGGGAGAANNN
NNNTTNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTAATTTTNAAATGGTTACCAANNNTA
AATAAAAAANNNNNNNNNNNNNNNTTTTTTNNNNTNTTTTTTTTNTTATATTAAATATAA
NNTAATTTNNTTTNNATTTAANTAAATTAAAAAAAAAAAAAAAAATAAATTNAATAAAAA
ATAAAAATTTTAAAATAAATTTTTTTTTAAAAAAAATTTAAATTTTNAATAAAGAATAAT
TAATTGGTTTTTTTTTGATTTTTATAAATTAAAANAGAGAAATATTTTNNTAAATTTTTT
NTAAATATTTATNAATATTAAAGAGGAGGAATAATAAAAAAGTGGAGGGGGGGTGGTTGT
GNAAATNNAGAGAGTTTTTAATTGAAGAAAATATATGGGGGGAAAATATT
GenBank Accession AL953018 [GenBank]
Graphic View Graphic view of gene At5g21030
Predicted Position of Insertion Chr5:7143132 - go to primer design
BLAST e Value 9e-39
Hit Clone Code (BAC ID) F22D1
Hit Gene Code At5g21030 [TAIR] [MIPS] [SIGnAL]
Gene Annotation PAZ domain-containing protein / piwi domain-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g04740

 
Sequence (A. th genome BLAST matches underlined)
>79-K016235-022-347-G10-8409
TGTCCTGAAATTTCCCGGACTGAAGCCATTTACATTGAATATATCCTGATTTTCTGATTT
TTTTTTTTGTTTCTCCCCCTGTTAGGGTAAAAATCCCCGGAAAATCCTGAAATTTAGAGC
CCTCCCTCCAAAACCAACTCCAAATAACCGGGTCTTTTGGCCCCTCTCTCCAAAATATAA
ACGGGATGTTGGAAGTGGAAATTAATTCTAAAACTTCCTTGTTTCGCTCACCGGTTCTCC
CGCTTGCCCGGGGGAATTTAGGTTAACTTGGAAAAAAGGGACCCAAACCTGGAAATTGGA
GGGGGTAGAAACTACTGTGCCGCATACCTTCCAAATGGAATCCCCCGGAATGTACGTATG
TAGGTTTTGACTACCTCTGTATCTATCTCTGCGGATTCCACGTCTATGTTGACATCAGCC
ATCACTTTGATCATCTCTACGACAAGACCTGGCCTGTCCGCTGTCTCTATGACAAGCAGG
CTATGGGATC
GenBank Accession AL953017 [GenBank]
Graphic View Graphic view of gene At5g04740
Predicted Position of Insertion Chr5:1368698 - go to primer design
BLAST e Value 2e-67
Hit Clone Code (BAC ID) T1E3
Hit Gene Code At5g04740 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ACT domain-containing protein
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 14.10.2014 10:23