Sequences from confirmation amplicon


Confirmation sequences for line 348F07 and hit At4g08390 are shown.
Line ID 348F07
Locus At4g08390 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:5314877
Primers used for PCR DT01 - 8474, show primer details
   
Sequence Name 13-K023368-022-348-F07C-8409
GenBank Accession LN491855 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>13-K023368-022-348-F07C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGGCAATATGTAAAGAGG
CGAAATCAAAGTTGATCAACAATTAAACACAAAAACCCTTAAGTTGACGTGGCTGTATCT
CTTCCAACTCTTAAAAATCAATTACTATTATACCCCTCAGAAAAATGGCAGAGCGTGTGT
CTCTCACACTCAACGGAACCCTCCTTTCTCCTCCTCCCACAACAACAACAACAACAATGT
CTTCTTCTCTCCGATCTACCACCGCCGCTTCTCTTCTCCTCCGCTCCTCCTCCTCCTCCT
CCAGATCCACTCTCACTCTCTCCGCTTCCTCCTCTCTCTCCTTCGTCAGATCTCTCGTCT
CTTCTCCACGTCTCTCTTCTTCTTCATCCCTCTCTCAGGTATATCTTCACTCTCTCCCTT
CCAATTTCCTTTATCTCTTCTATATCTGAATCTGATTTTGTAATTTCCACGATCTAATTT
GATTTCAGAAGAAATATCGAATTGCGTCGGTGAATCGGAGTTTCAACTCCACCACCGCCG
CTACTAAATCTTCATCTTCAGATCCTGATCAGTTGAAGAACGCTAGAGAAGATATCAAAG
AGCTTCTCAGCACCAAATTCTGCCATCCGATTTTGGTTAGATTAGGTTGGCATGATGCTG
GTACGTATAACAAGAACATTAAGGAATGGCCACAAAGAGGTGGAGCTAA
   
Sequence Name 14-K023368-022-348-F07C-DT01
GenBank Accession LN492324 [GenBank]
Sequencing primer gene specific primer, DT01: 5'-ATCGAATCTCAAACTTCCATTAGC-3'
Sequence (A. th genome BLAST matches underlined)
>14-K023368-022-348-F07C-DT01
ATCTTTGTGGCCATTCCTTAATGTTCTTGTTATACGTACCAGCATCATGCCAACCTAATC
TAACCAAAATCGGATGGCAGAATTTGGTGCTGAGAAGCTCTTTGATATCTTCTCTAGCGT
TCTTCAACTGATCAGGATCTGAAGATGAAGATTTAGTAGCGGCGGTGGTGGAGTTGAAAC
TCCGATTCACCGACGCAATTCGATATTTCTTCTGAAATCAAATTAGATCGTGGAAATTAC
AAAATCAGATTCAGATATAGAAGAGATAAAGGAAATTGGAAGGGAGAGAGTGAAGATATA
CCTGAGAGAGGGATGAAGAAGAAGAGAGACGTGGAGAAGAGACGAGAGATCTGACGAAGG
AGAGAGAGGAGGAAGCGGAGAGAGTGAGAGTGGATCTGGAGGAGGAGGAGGAGGAGCGGA
GGAGAAGAGAAGCGGCGGTGGTAGATCGGAGAGAAGAAGACATTGTTGTTGTTGTTGTTG
TGGGAGGAGGAGAAAGGAGGGTTCCGTTGAGTGTGAGAGACACACGCTCTGCCATTTTTC
TGAGGGGTATAATAGTAATTGATTTTTAAGAGTTGGAAGAGATACAGCCACGTCAACTTA
AGGGTTTTTGTGTTTAATTGTTGATCAACTTTGATTTCGCCTCTTTACATATTGCCAGGA
TATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCANCAATGAGTATG
ATGGT

Last Updated on 23.10.2014 13:25