SimpleSearch - Line and FST details


Line specific information

 
Line ID 348F07
Vector Used pAC161
Line Availability only available from NASC (N433379)
Segregation Analysis 100:100:92
Confirmed for Hit At4g08390
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g23540

 
Sequence (A. th genome BLAST matches underlined)
>54-K016243-022-348-F07-8409
TATCCTGAAATTTCCCGGACTGAAGCCATTTACATTGAATATATCCTGACAATTCGATTG
TAAAATTCTATTACCTCTTTTCCCTAAGTCACAAAATCCCGAGTGAACCACGATTTGGAT
ATTGAAATCGATGCCTGCTCAGCTAAACCAATTTTACTCCTATGGAGATCTCNCCTATCG
TGAGTCTCTCACACTCGACAGAACCCTCCTTTCTCCTCCTCCCACAACAACAACAACAAC
GATGTCTTCTTCTCTCCTATCTACCACCGCCGCTTCTCTTCTCCTCCGCTCCTCCTCCTC
CTCCTCTATATCCACTCTCACTCTCTCCGCTTCCTCCTCTCACTACATCCGCAGATCGCT
CTCCTCTACTCCACGAATCTCTTCTTCTTCATCCCTCTCCCACGAATATCACCACTCCCC
CCCTCCCAATTTCCCTTATCTCTTCAATCTACGAATCATGACCTAGAACTTCCACAATCG
AATTTGAGCTCAAAAGAAATATCGAATAGCGTCAATGAGTCTGACCTTCATACTCCACCA
CCGCCGCTACTACTTCTTCATCATACCATCCAGATCAGCATGAAAAACGCTTGCTCACGC
CCCCTTTTAATGGAGAATTTCCTCTAATAAACTCTTTAACCGAACATTGTATTGATTTGC
TATGGGA
GenBank Accession AL953119 [GenBank]
Graphic View Graphic view of gene At2g23540
Predicted Position of Insertion Chr2:10026179 - go to primer design
BLAST e Value 4e-16
Hit Clone Code (BAC ID) F26B6
Hit Gene Code At2g23540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GDSL-like Lipase/Acylhydrolase superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status unknown

Gene hit At4g08390

 
Sequence (A. th genome BLAST matches underlined)
>54-K016247-022-348-F07-8409
TATCCTGAAATTTCCCGGACATGAAGCCATTTACATTGAATATATCCTGACAAATTCATT
GTAAAATTCGATTACCTCTTTTCCCAAAGTTTTCAAAATCGGAGTGAACCAGGATTTGGA
TATTGAAATCGAGTCGGTTCAGTTAAACCGATTTTAACCTATGGGATCCTCCCTATAGTG
AGACTCTCACACTCAACGGAACCCTCCTTTCTCCTCCTCCCACAACAACAACAACAATCA
TGACTTCTTCTCTCCTATCTACCACCGCCGCTTCTCTTCTCCTCCGCTCCTCCTCCTCCT
CCTCCAAATCCACTCTCACGCTCTCCGCTTCCTCCTCACACTCCTACGTAAGATATCTCT
CCTCTACTCCGCGTCTCTCTTCTTCTTCATCCCTCTCTCAAGTATATCTACACTCTCTCC
CTTCCAATTTCCTTTATCTCTTCAATATCTGAATCTGATGTTGTAATTTCCACGATCTAA
TGTGACTTCAGAAGAAATATCGAATTGCGTCGGAGAATCGGAGTTTCAACTCCACCACCG
CCGCTACTAAATCTTCATCTTCAGATCCTGATCAGTTGAAGAACACTATGGGAT
GenBank Accession AL953120 [GenBank]
Graphic View Graphic view of gene At4g08390
Predicted Position of Insertion Chr4:5314890 - go to primer design
BLAST e Value 8e-73
Hit Clone Code (BAC ID) T28D5
Hit Gene Code At4g08390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation stromal ascorbate peroxidase
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03