Sequences from confirmation amplicon


Confirmation sequences for line 349F05 and hit At5g07990 are shown.
Line ID 349F05
Locus At5g07990 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr5:2562714
Primers used for PCR ZZ76 - 8474, show primer details
   
Sequence Name 27-K021971-022-349-F05C-8409
GenBank Accession LN498195 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>27-K021971-022-349-F05C-8409
GTAGATTTCCCGGACATGAAGCCATTTACAATTATAATTGATTGGGAATTAGCTGGAGGA
GTTACGCCGGAGAAGCTGAATATGGAGGAGAGTTATGGGCTTACACTGCAAAGAGCGGTT
CCTTTGGTGGTACATCCTAAGCCAAGGTTGGCTCCGAACGTTTATGGACTCGGGTCGGGT
TAAAATTTAACTTTGCTTCTTGGACAAGGTATATGGCTTGCACGAAAATAAAGTTTTAAA
ACAGCGTAGTTTGATCCGGAGTTAGCTTTATGTAAGAACGTGTAACGCCAAATCAAGTCA
TTATTAAATATTGTGAGTTGTTTGTAACCTATATATAAATCTTGAAGAGGAAGATTTCAG
AAATCTTGAATATGTTTTAGGAAAAACATTGTTTTTTTTACAGTAGCGCAAGTTGAATTA
AAACCTATTCCTTACAGAACCAAATGCATTAATAATTCTAGATATTTTTGGCCAAGACAA
TCAGATTTTTCAATATTTCATATATACTAGGTGGAACACCACCACCTGCAACTCTGCAAC
ACATGTTACGTTACACAATCACTT
   
Sequence Name 28-K021971-022-349-F05C-ZZ76
GenBank Accession LN498665 [GenBank]
Sequencing primer gene specific primer, ZZ76: 5'-TAAATAATTGAAAACCGCCAAAAG-3'
Sequence (A. th genome BLAST matches underlined)
>28-K021971-022-349-F05C-ZZ76
TGTGTAACGTAACATGTGTTGCAGAGTTGCAGGTGGTGGTGTTCCACCTAGTATATATGA
AATATTGAAAAATCTGATTGTCTTGGCCAAAAATATCTAGAATTATTAATGCATTTGGTT
CTGTAAGGAATAGGTTTTAATTCAACTTGCGCTACTGTAAAAAAAACAATGTTTTTCCTA
AAACATATTCAAGATTTCTGAAATCTTCCTCTTCAAGATTTATATATAGGTTACAAACAA
CTCACAATATTTAATAATGACTTGATTTGGCGTTACACGTTCTTACATAAAGCTAACTCC
GGATCAAACTACGCTGTTTTAAAACTTTATTTTCGTGCAAGCCATATACCTTGTCCAAGA
AGCAAAGTTAAATTTTAACCCGACCCGAGTCCATAAACGTTCGGAGCCAACCTTGGCTTA
GGATGTACCACCAAAGGAACCGCTCTTTGCAGTGTAAGCCCATAACTCTCCTCCATATTC
AGCTTCTCCGGCGTAACTCCTCCAGCTAATTCCCAATCAATTATAATTGTAAATGGCTTC
ATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAA
AGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAA
ATGAAAGTACATTTTGATAAAACGACAAA

Last Updated on 23.10.2014 13:25