SimpleSearch - Line and FST details


Line specific information

 
Line ID 349F05
Vector Used pAC161
Line Availability only available from NASC (N433473)
Segregation Analysis 50:48:46
Confirmed for Hit At5g07990 At1g64430
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g07990

Sequence (A. th genome BLAST matches underlined)
>38-K016244-022-349-F05-8409
TTTCCCGGACTGAACCATTTACATTATAATTGATTGGGAATTAGCTGGAGGAGTTACGCC
GGACAAGCTGAATATGGAGGAGAGTTATGGGCTTACACTGCAAAGAGCGGTTCCTTTGGT
GGTACATCCTAAGCCAAGGTTGGCTCCGAACGTTTATGGACTCGGGTCGAGATAAAATAT
AACTTTGCTTCTTGGACAAGGTATATGGCTTGCACTAAAATAGAGTTTTAAAACAGCGTA
GTTTGATCCTGAGTTAGCTTTATGTAAGAACGTGTAACGCCAAATCAAGTCATTATTAAA
TATTGTGAGTTGTTTGTAACCTATATATAAATCTTGAAGAGGAAGATTTCAGAAATCTTG
AATATGTTTTAGGAAAAACATTGTTTTTTTTACAGTAGCGCAAGTTGAATTAAAACCTAT
TCCTTACAGAACCAAATGCATTAATAATTCTATGGG
GenBank Accession AL953244 [GenBank]
Graphic View Graphic view of gene At5g07990
Predicted Position of Insertion Chr5:2562714 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F13G24
Hit Gene Code At5g07990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cytochrome P450 superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Rosso et al. 2003, f3prhGK01] [Yin et al. 2013, tt7] [Stracke et al. 2010, tt7-6]

Gene hit At1g64430

 
Sequence (A. th genome BLAST matches underlined)
>38-K016248-022-349-F05-8409
TACATTGAATTGTTCGGAATCTTTTGTGTGAATTCGCCTGATAAGTGAATATGGACGAAA
GTATGGGTTTACCGTGTCATAGCGATTCGTAATGCGTTTTTTCCTAAATGCAGCGTTGGT
TACGAAAATTATTGAGCACGTGCTAAACACACAAAGTAGACTCTTTTCTCCAGAGAATGT
GTGACGTTAAGTACTTAATTGAAGTATTAATTAGTATGGTATAAACCAAAAAGCCACGTG
GCGTTCTCTTCTCCACTCCTCTTTTTATTCCTTCCCAAACAATAAGGGTAGTTATGTATT
ATTTCCAGAGAACCTTCTCATGAGAATCTCTCACTCTCTCTTTCTGCATCACCACTTCGA
GCTTCGATGGTTGGGAATATTCTGGTGACCGGAGGCGCTGGCTACCTCAGAAGTCACACG
GATCTTCACCTTCTTCTCGGAGGGCTATAACACCGTCGTTATAGACAACCTCGACAATTC
CTCTCTCGTTTCGATCCAACGCGTCAAGGATCTCGCCGGAGATCATGGACAAAATCTCAC
CGTCCACCAGGTTTGGCTATCTTTTCCCTTGCTCTGCTCTTTGGATCATTGCATTCTGAG
AATTTCGGTAATCATGACCTCAAAAATTGAGAGTTTTTTTTTTGTATCTCAATTTGCTTA
CAAGGCTTTGGGA
GenBank Accession AL953245 [GenBank]
Graphic View Graphic view of gene At1g64430
Predicted Position of Insertion Chr1:23936770 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F15H21
Hit Gene Code At1g64430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pentatricopeptide repeat (PPR) superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40