Sequences from confirmation amplicon


Confirmation sequences for line 350E02 and hit At2g26975 are shown.
Line ID 350E02
Locus At2g26975 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:11513013
Primers used for PCR NC48 - 8474, show primer details
   
Sequence Name 37-K101269-0022-350-E02C-8409
GenBank Accession LN502549 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>37-K101269-0022-350-E02C-8409
TTGAATATATCATGAAGCCATATTATATGATAAGTTTCTGAAATTTTTTGTTTGGGACAA
AACTTAGAGAAAATGGTTTCGTATTTATTGTGATGTTCTTGTTATCATGTGGTCTCTTAA
ATGTGTTTGTGGTTGTACTCACGTTTTGACTTGTCAAACTTTGTGTAGTACAAGTAGAAG
TCAATACTAATTTTAGAAAGCCTTTTAAATACCTATTCAGTTATTCAACTTATTTTCATG
ATATAAATGGTAACACACCATTTGTAGAATTGTGGTGGAAGAAAAACGATTTACATCATT
TGAACATAATTTGAGAAAGTGATGAAATTTATATTCGTAGTGGAATTTAACAAGTTATTC
TTCTAAACGATATTTACTTATAAATCAATGACAACAACATTGTGTTAAGCTTATGAGTTT
CAAGTTCAGTTCAATCAACAAAATGCAACTCTCCCCAATTCATCACTTGCAAAACTCTAA
ACATAGACCAAAGAAATTAGGCAAACCCAAACCTACGAAGACTTATCAAAATATAAAAAT
GTAAATTTGGCTCANAACCTTGGACAAGAAACATATCANTCTAGGTCTAAAATTCACTGG
TTCGTCACAACCCATTCTAGAAAATTCGAAAACAAGGACAAAA
   
Sequence Name 37-K101275-0022-350-E02C-NC48
GenBank Accession LN502550 [GenBank]
Sequencing primer gene specific primer, NC48: 5'-GTATTGGTTCGTTTTGTCCTTGTT-3'
Sequence (A. th genome BLAST matches underlined)
>37-K101275-0022-350-E02C-NC48
ATTTAGACCTAGATTGATATGTTTCTTGTCCAAGGTTTTGAGCCAAATTTACATTTTTAT
ATTTTGATAAGTCTTCGTAGGTTTGGGTTTGCCTAATTTCTTTGGTCTATGTTTAGAGTT
TTGCAAGTGATGAATTGGGGAGAGTTGCATTTTGTTGATTGAACTGAACTTGAAACTCAT
AAGCTTAACACAATGTTGTTGTCATTGATTTATAAGTAAATATCGTTTAGAAGAATAACT
TGTTAAATTCCACTACGAATATAAATTTCATCACTTTCTCAAATTATGTTCAAATGATGT
AAATCGTTTTTCTTCCACCACAATTCTACAAATGGTGTGTTACCATTTATATCATGAAAA
TAAGTTGAATAACTGAATAGGTATTTAAAAGGCTTTCTAAAATTAGTATTGACTTCTACT
TGTACTACACAAAGTTTGACAAGTCAAAACGTGAGTACAACCACAAACACATTTAAGAGA
CCACATGATAACAAGAACATCACAATAAATACGAAACCATTTTCTCTAAGTTTTGTCCCA
AACAAAAAATTTCAGAAACTTATCATATAATATGGCTTCATGATATATTCAATTGTAAAT
GGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAA
NAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATATCCG
Primers used for PCR NC49 - 8474, show primer details
   
Sequence Name 38-K101269-0022-350-E02C-OriL
GenBank Accession LN502911 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>38-K101269-0022-350-E02C-OriL
GAGCCTTTACAATTGAATATATCCTGAAGAAACCATTTACGAAACCATTTTCTCTAAGTT
TTGTCCCGGACATGAAGCCAGTTTTGATCCATCATCACCATCATCAATGGTAAATCATAC
CAATTCCAACATGATCATGATGCATATGACTTTCTTCTGGGGAAAGAACACGGAGATACT
CTTCTCCGGCTGGCCCGGGACAAGTCTCGGCATGTACGTTCTATGTCTCATCGTCGTCTT
CCTCCTTGCTGTTATCGTCGAGTGGCTTGCCCATTCTTCGATCCTTCGTGGACGTGGCTC
CACTAGCCGCGCCAAGGGGCTCGTTCAGACCGCAGTCTACACACTCAAGACAGGCCTTGC
TTATCTCGTGATGCTCGCCGTTATGTCCTTTAACGGTGGAGTTTTCATTGTCGCTATCGC
CGGATTCGCCGTGGGTTTCATGCTCTTCGGAAGCACTGCTTTCAAGAACCCCTCTGATGA
CGAGAAACCCTTCGAACAACTATGATCACTCTTTATTTTACTTGGAAAGAACATTTCGTT
TGTGTGTATTTAATTTGCGTTTCTTTGAATTTTGATATTTTGTGACTAGAATTTGGAATT
TTATGAAGAATATAGCCNTTTTTGCATTTTATTGTAGATGATGTAGTCATGTAGATGATA
AATTTCAACCACAAATTAAATAACA
   
Sequence Name 38-K101275-0022-350-E02C-NC49
GenBank Accession LN502912 [GenBank]
Sequencing primer gene specific primer, NC49: 5'-GACGGCGTTTGTTATTTAATTTGT-3'
Sequence (A. th genome BLAST matches underlined)
>38-K101275-0022-350-E02C-NC49
ATCATCTACATAAAATGCAAAAATGGCTATATTCTTCATAAAATTCCAAATTCTAGTCAC
AAAATATCAAAATTCAAAGAAACGCAAATTAAATACACACAAACGAAATGTTCTTTCCAA
GTAAAATAAAGAGTGATCATAGTTGTTCGAAGGGTTTCTCGTCATCAGAGGGGTTCTTGA
AAGCAGTGCTTCCGAAGAGCATGAAACCCACGGCGAATCCGGCGATAGCGACAATGAAAA
CTCCACCGTTAAAGGACATAACGGCGAGCATCACGAGATAAGCAAGGCCTGTCTTGAGTG
TGTAGACTGCGGTCTGAACGAGCCCCTTGGCGCGGCTAGTGGAGCCACGTCCACGAAGGA
TCGAAGAATGGGCAAGCCACTCGACGATNACAGCAAGGAGGAAGACGACGATAAGACATA
GAACGTACATGCCGAGACTTGTCCCGGGCCAGCCGGAGAAGAGTATCTCCGTGTTCTTTC
CCCAGAAGAAAGTCATATGCATCATGATCATGTTGGAATTGGTATGATTTACCATTGATG
ATGGTGATGATGGATCAAAACTGGCTTCATGTCCGGGACAAAACTTAGAGAAAATGGTTT
CGTAAATGGTTTCTTCAGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTAC
ATGGATCAGCAATGAGTATGATGGTCAATATGGAGAANAAGAAAGAGTAATTACCAATTT
TTTTTCAATTCANAAATGTAGATT

Last Updated on 07.07.2016 14:16