SimpleSearch - Line and FST details


Line specific information

 
Line ID 350E02
Vector Used pAC161
Line Availability only available from NASC (N433554)
Segregation Analysis 50:39:33
Confirmed for Hit At2g26975
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g26975

 
Sequence (A. th genome BLAST matches underlined)
>13-K016245-022-350-E02-8409
TATCATGAAATTTCCCGGACATGAAGCCATTTACATTGAATATATCCTGAAGAAACATTT
ACGATACCATTTTCTCTATGTTTGGTCCCGGACATGAATCCAGATTTGGATCCTCATCAC
CATCGTATGTGGTAAATCATACCAGTTCCAACATGATGCATGATGCGTATGACTTTCTTC
TGGGGAAAGAACACGGAGATACTCTTCTCCGGATGGCCCGGGACAAGTCTCGGCATGTAC
GTTCTATGACTCATCGACGCCTTCCTCCTTGCTGATATCGACGAGTGGCTTGCCCATTCT
TCAATCCTTCGTGGACGTGGCTCCGCTATGGGATCCTCCCCTATAGTGAGANAGTGATGA
AATTTATATTCGTAGTGGAATTTAACAAGTTATTCTTCTAAACGATATTTACTTATAAAT
CAATGACAACAACATTGTGTTAAGCTTATGAGTTTCAAGTTCAGTTCAATCAACAAAATG
CAACTCTCCCCAATTCATCACTTGCAAAACTCTAAACATACACCAAAGAAATTAGGCAAA
CCCCAACCTACGAAGACTTATCAAAATATAACAATGTAAATTTGGCTCAAAACCTTGGAC
AAGAAACATATCAATCTATGGGA
GenBank Accession AL953350 [GenBank]
Graphic View Graphic view of gene At2g26975
Predicted Position of Insertion Chr2:11512991 - go to primer design
BLAST e Value 3e-143
Hit Clone Code (BAC ID) T20P8
Hit Gene Code At2g26975 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ctr copper transporter family
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL953351 [GenBank]


Last Updated on 07.07.2016 14:03