Sequences from confirmation amplicon


Confirmation sequences for line 351H05 and hit At1g49120 are shown.
Line ID 351H05
Locus At1g49120 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:18174362
Primers used for PCR PH60 - 8474, show primer details
   
Sequence Name 03-K017549-022-351-H05C-PH60
GenBank Accession LN487274 [GenBank]
Sequencing primer gene specific primer, PH60: 5'-CGAATTCTACAGGGAATAAAGCAG-3'
Sequence (A. th genome BLAST matches underlined)
>03-K017549-022-351-H05C-PH60
CGGAACCGGAAGCGTCGTCGGGTTTCAAAGGCGTACGACGGAGGCCGTGGGGGAAATTTG
CGGCGGAGATAAGAAATCCGTTTGAGAAGAAGAGAAAGTGGCTTGGAACGTTTCCTACTG
AAGAAGAAGCAGCAGAAGCTTACCAAAAGAGTAAAAGAGAGTTTGATGAACGATTGGGTT
TAGTTAAACAGGAAAAAGACCTAGTAGATTTGACCAAGCCGTGCGGTGTACGTAAACCAG
AAGAGAAGGAAGTTACTGAGAAGTCGAATTGCAAAAAGGTAAATAAGAGAATTGTTACTG
ATCAGAAGCCATTTGGTTGTGGTTATAACGCTGATCATGAAGAAGAGGGAGTGATTAGTA
AAATGTTGGAAGATCCGTTGATGACATCGTCAATTGCTGATATTTTTGGTGATTCGGCTG
TTGAAGCAAATGATATTTGGGTGGATTACAATTCAGTGGAATTTATTTCCATTGTAGATG
ATTTCAAGTTTGATTTTGTGGAGAATGATAGAGTAGGAAAGGAGAAAACATTTGGATTTA
AGATTGGGGATCACACTAAAGTTAATCAACATGCCAAAATCGTATCGACCAATGGGGACT
TATTCGTCGATGATTTACTTGATTTTGATCCGTTGATAGATGATTTTAAGTTAGAAGATT
TTCCTATGGATGATCTTGGATTATTAGGAGA
   
Sequence Name 04-K017549-022-351-H05C-8409
GenBank Accession LN487716 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>04-K017549-022-351-H05C-8409
GATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTCTGGATCTCCTAATAATCC
AAGATCATCCATAGGAAAATCTTCTAACTTAAAATCATCTATCAACGGATCAAAATCAAG
TAAATCATCGACGAATAAGTCCCCATTGGTCGATACGATTTTGGCATGTTGATTAACTTT
AGTGTGATCCCCAATCTTAAATCCAAATGTTTTCTCCTTTCCTACTCTATCATTCTCCAC
AAAATCAAACTTGAAATCATCTACAATGGAAATAAATTCCACTGAATTGTAATCCACCCA
AATATCATTTGCTTCAACAGCCGAATCACCAAAAATATCAGCAATTGACGATGTCATCAA
CGGATCTTCCAACATTTTACTAATCACTCCCTCTTCTTCATGATCAGCGGTATAACCACC
ACCAAATGGGTTCTGATCAATAACCATTCTCCTATTTACCTTTTT

Last Updated on 23.10.2014 13:25