SimpleSearch - Line and FST details


Line specific information

 
Line ID 351H05
Vector Used pAC161
Line Availability only available from NASC (N433689)
Segregation Analysis 50:49:47
Confirmed for Hit At1g49120
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g49120

 
Sequence (A. th genome BLAST matches underlined)
>40-K016250-022-351-H05-8409
CTCGTTTTTGTAATCTAAGTAATTAACCTCGCTTTGATTTTGATTTATTCTCTTTCTATG
GGATATCCCTATGAAGACGTATGCTTGAACGGCCAACGGTATGAGCACAATGCTACAATC
TTTGAGTACAAGTTGTTAGATATTCGGTTTGGCCCATGCAATAACTGCTGATATAAAGAG
ATTTACCTCTTAAGAGAAGCTTTTACTAAGCTTGCATCATCTACTGTGGAAATAACTTCT
ACTGAATTGTAACCCACCCAAATATCATTAGCTTGACGACCCAATCAGCAAATACCCACT
ATTGGCGATGTCATCAACGGATCTTCCAGCATTTTACTAATCACTCCCTCTTCTTCTGAT
CAGAGTTATAACCACAACCAGATGGCTTCTGATCAGTAACAATTCTCTTATTTACCTTTT
TGCAATTCGACTTCTCAGGAACTTCCTTCTCTTCTGGTTTACGTACACCGCACGGCTTGG
TCAAATCTACTATGGGATCCTCCCCTATAATGAG
GenBank Accession AL953529 [GenBank]
Graphic View Graphic view of gene At1g49120
Predicted Position of Insertion Chr1:18174346 - go to primer design
BLAST e Value 1e-93
Hit Clone Code (BAC ID) F27J15
Hit Gene Code At1g49120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrase-type DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g58060

 
Sequence (A. th genome BLAST matches underlined)
>40-K016246-022-351-H05-8409
GCCTGTGGAGCGTAGAGGAAATATCGTTTTTGTAATTAAGTAATTAACCTCGCTTTGATT
TTGATTTATTCTCTTTCTATGGGATCCTCCCTATAGTGAGAAACAAGACCGGCCCACGGT
ATACAGCCCAATACTATTTTCTTGTAGGTACTAGTCGTGGGTTATTTCATCTAGGTTTCT
GTAAATATCTGGTGATTCCACAAGATTTGCTCAATACATATGCTCCTCCTCATGGTCGGA
TGATATAGCAATAAACACTATGATTCTTATATACCAAACCTACTAATTCCAAATTCGAAC
TGTATAGGTCATACTGCACTCAATTGTCTGTAGGCTGAAGCAGAAAGCTTTTTCCTAGAA
GGTATTCTANATCCACGTTCTTCCTCTATTTATCTACCCCAACAATAACATGCAGTAGTT
CCTCTATCAATCAACAACACTTATAAGCCTGCTAAATCAACCACCCTTTCTAACGTGTTC
ACCAACTATGCTCAGAGATCGAGACAGGGAAAAAAGGAAACTAAATCTATAAGCAATTTC
TATGGGATCTCCCCNAATAGTGAGACANGNCCNNCNTTNGAATCTTTGACTCCCGGGGAA
GTGGG
GenBank Accession AL953528 [GenBank]
Graphic View Graphic view of gene At5g58060
Predicted Position of Insertion Chr5:23500150 - go to primer design
BLAST e Value 4e-130
Hit Clone Code (BAC ID) K21L19
Hit Gene Code At5g58060 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SNARE-like superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 07.07.2016 14:03