Sequences from confirmation amplicon


Confirmation sequences for line 353B11 and hit At4g10760 are shown.
Line ID 353B11
Locus At4g10760 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr4:6623376
Primers used for PCR MF01 - 8474, show primer details
   
Sequence Name 07-K020887-022-353-B11C-8409
GenBank Accession LN489064 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>07-K020887-022-353-B11C-8409
TAGATTTCTCTTTAACTTTCTTTCAAGCTAAAGACCTGCACAAACTCTCTCTCGAATTCT
TTTGTTTCGAAGCCATGGAAACTGAATCTGATGACGCCACCATTACCGTCGTCAAAGACA
TGAGAGTTCGATTAGAGAATCGAATTCGAACCCAACACGACGCTCACTTAGATCTCCTTT
CCTCACTCCAATCCATTGTTCCCGATATAGTCCCATCTCTCGATCTCTCACTCAAACTCA
TCTCTTCTTTCACGAATCGACCTTTCGTAGCTACACCACCATTACCAGAACCCAAAGTTG
AGAAGAAGCATCATCCGATTGTTAAATTAGGAACCCAACTGCAACAATTACATGGGCATG
ATTCAAAATCGATGCTTGTTGATTCGAATCAGAGAGATGCTGAAGCTGATGGGTCTAGTG
GGAGTCCTATGGCGCTTGTTAGAGCTATGGTTGCTGAGTGTTTGCTTCAACGTGTACCGT
TTTCTCCTACGGATTCTTCTACTGTGCTTAGGAAGCTTGAGAATGACCAGAATGCTAGAC
CGGCGGAGAAGGCGGCGTTACGAGATTTAGGCGGTGAATGTGGACCGATTCTTGCGGTGG
AGACCGCACTTAAATCGATGGCGGAAGAGAATGGTTCTGTGGAATTGGAAGAGTTTGAGG
TTAGTGGGAAGCCTAGGATCATGGTTTTAGCTATAGATAGAACTAGATTGCTTAAAGAGT
TACCAGAGAGTT
   
Sequence Name 08-K020887-022-353-B11C-MF01
GenBank Accession LN489532 [GenBank]
Sequencing primer gene specific primer, MF01: 5'-ATTCGTTATTCCCTTGGAAACTCT-3'
Sequence (A. th genome BLAST matches underlined)
>08-K020887-022-353-B11C-MF01
GAACTCTTTAAGCAATCTAGTTCTATCTATAGCTAAAACCATGATCCTAGGCTTCCCACT
AACCTCAAACTCTTCCAATTCCACAGAACCATTCTCTTCCGCCATCGATTTAAGTGCGGT
CTCCACCGCAAGAATCGGTCCACATTCACCGCCTAAATCTCGTAACGCCGCCTTCTCCGC
CGGTCTAGCATTCTGGTCATTCTCAAGCTTCCTAAGCACAGTAGAAGAATCCGTAGGAGA
AAACGGTACACGTTGAAGCAAACACTCAGCAACCATAGCTCTAACAAGCGCCATAGGACT
CCCACTAGACCCATCAGCTTCAGCATCTCTCTGATTCGAATCAACAAGCATCGATTTTGA
ATCATGCCCATGTAATTGTTGCAGTTGGGTTCCTAATTTAACAATCGGATGATGCTTCTT
CTCAACTTTGGGTTCTGGTAATGGTGGTGTAGCTACGAAAGGTCGATTCGTGAAAGAAGA
GATGAGTTTGAGTGAGAGATCGAGAGATGGGACTATATCGGGAACAATGGATTGGAGTGA
GGAAAGGAGATCTAAGTGAGCGTCGTGTTGGGTTCGAATTCGATTCTCTAATCGAACTCT
CATGTCTTTGACGACGGTAATGGTGGCGTCATCAGATTCAGTTTCCATGG

Last Updated on 07.07.2016 14:16