SimpleSearch - Line and FST details


Line specific information

 
Line ID 353B11
Vector Used pAC161
Line Availability only available from NASC (N433815)
Segregation Analysis 50:50:50
Confirmed for Hit At1g18400 At4g10760
Parent of DUPLO pair 2298
Parent of pair(s) none

Gene hit At1g18400

 
Sequence (A. th genome BLAST matches underlined)
>82-K016363-022-353-B11-8409
TATCCTGAAATTTCCCGGACATGAAGCCTTTACATTGAATATATCCTGAATCTTTCCATT
ACATGCAGAATTTTTCTCTCAATATTATCCCTCTCTTCTTATCTAGCGGCTATCACTCTC
TCATATGAAGAGACTTCTCCGTCTACAAGTATCTGATTCGATCATATATAATGAAAACGT
ACCTCGCCTAATGTGCACCTCCCATGGGATCCTACNCTATAGTGAGANNNACNTTNCAAA
NTAAAACTCATCTCTTCTTACACGAATCCTACTATATTAATCACTGCATTATTACCTTAT
CCCATCCGGGCCCCGTATCTTCCTCCCATCGTAATCTCTCGATCCCTTTCGCTCACCTAC
CCTGACATTTTTACATATACTGTGCTACGTGTATATAAATCTAAAAGAATCCGCCACTGA
TATAACTATGATGATCCTCTCTATACAATGTAAGCAATTTTACCCGTTCTGCTAAGCTGT
GGCTATCAGTGGCTTGGCCTCTTCTGGCTCTCACATGAACAACTTCTCTCTCTTTCTCGN
CTTCTTCTTCCTTCTTCTTCTTCAACCTCTTACCTCTTCTCAAAGAACCCTATGGGAT
GenBank Accession AL953667 [GenBank]
Graphic View Graphic view of gene At1g18400
Predicted Position of Insertion Chr1:6332454 - go to primer design
BLAST e Value 1e-19
Hit Clone Code (BAC ID) F15H18
Hit Gene Code At1g18400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BR enhanced expression 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g10760

 
Sequence (A. th genome BLAST matches underlined)
>82-K016362-022-353-B11-8409
TATTGAACAGATCCAACTCTCTCTCCAGGACTTGAAGCCCTAATTCACGGTAACCGAACC
TCATGACATCACCATTACCATCACTTTGTACATGATGAGCCTATTACAGATCCAAATCCT
GACCGAACGCGACGATAAATATATATACTCGTTGCATCCCTACACACCTCCTCATTGATG
GCGCATACATCGCTACCATCTACGCGATCTCTCACTCAAACTCATCTCTTCTTTCACGAA
TCGACCTTTCGTAGCTACACCACCATTACCAGAACCCAAAGTTGAGAAGAAGCATCATCC
GATTGTTAAATTAGGAACCCAACTGCAACAATTACATGGGCATGATTCAAAATCGATGCT
TGTTGATTCGAATCAGAGAGATGCTGAAGCTGATGGGTCTATGGGATCCCCCTAATAGTG
AG
GenBank Accession AL953666 [GenBank]
Graphic View Graphic view of gene At4g10760
Predicted Position of Insertion Chr4:6623344 - go to primer design
BLAST e Value 2e-107
Hit Clone Code (BAC ID) T12H20
Hit Gene Code At4g10760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation mRNAadenosine methylase
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03