Sequences from confirmation amplicon


Confirmation sequences for line 354B01 and hit At3g08010 are shown.
Line ID 354B01
Locus At3g08010 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr3:2556189
Primers used for PCR JR01 - 8474, show primer details
   
Sequence Name 49-K022411-022-354-B01C-8409
GenBank Accession LN506694 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>49-K022411-022-354-B01C-8409
AGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGAGAGACGAAACGGCAGC
GTTTCAACAGAGTTTCGGAGGAGAAGAGATGATGGGTTTTGATGGGTTTAGTAAAAGAAG
AGGGTTTAGGGATTCTCGGAAGTGATGGTGTCTGGATTCGCCTTGTGTTAAAGCCTAACG
TCGCCATTGAAAAGGAGTAGGCTTTAGGAAGAAAGCAGAGGAAGAAGAAGAAGAAATGAT
TTATCCTTTTCGGTTACTCCTTCCTCATCCACAAAGATATTTCAATAATAAAATAAGTTT
TTTTTTTGTTTGGCTCCTTATTTTTTGGTGGTCACTTATATAAATAAAAAAAACTTCAAA
CCCAAAACAAAGCTTAAATTTGAAGAAACAAGTTTTTGTGATCATGATGAAAAATGGTAT
TGAGCTATTAGTGAGACGAGTTTCAGCGATACCTCAACACTCTATTTCTTCTAGCTTCCA
TTTTCTTCCTCAATTTTGCACTTCTTCTTCTGCATCGCCCAGTTCCAAGCTATTCATCGG
AGGTTAAGAGTATTGTAACAAAGTACCCACATTTACATATGTAGATGATAATGAATGATT
TTTGATACCCGTAAGTATGCAGGAATTGTCCTGGTCTGTGGATGAGCAAT
   
Sequence Name 50-K022411-022-354-B01C-JR01
GenBank Accession LN507039 [GenBank]
Sequencing primer gene specific primer, JR01: 5'-AGAGAAAGCGTCTTTGAGAGATTG-3'
Sequence (A. th genome BLAST matches underlined)
>50-K022411-022-354-B01C-JR01
TCCACAGACCAGGACAATCCTGCATACTTACGGGTATCAAAAATCATTCATTATCATCTA
CATATGTAAATGTGGGTACTTTGTTACAATACTCTTAACCTCCGATGAATAGCTTGGAAC
TGGGCGATGCAGAAGAAGAAGTGCAAAATTGAGGAAGAAAATGGAAGCTAGAAGAAATAG
AGTGTTGAGGTATCGCTGAAACTCGTCTCACTAATAGCTCAATACCATTTTTCATCATGA
TCACAAAAACTTGTTTCTTCAAATTTAAGCTTTGTTTTGGGTTTGAAGTTTTTTTTATTT
ATATAAGTGACCACCAAAAAATAAGGAGCCAAACAAAAAAAAAACTTATTTTATTATTGA
AATATCTTTGTGGATGAGGAAGGAGTAACCGAAAAGGATAAATCATTTCTTCTTCTTCTT
CCTCTGCTTTCTTCCTAAAGCCTACTCCTTTTCAATGGCGACGTTAGGCTTTAACACAAG
GCGAATCCAGACACCATCACTTCCGAGAATCCCTAAACCCTCTTCTTTTACTAAACCCAT
CAAAACCCATCATCTCTTCTCCTCCGAAACTCTGTTGAAACGCTGCCGTTTCGTCTCTCA
GGATATATTCA

Last Updated on 07.07.2016 14:16