SimpleSearch - Line and FST details


Line specific information

 
Line ID 354B01
Vector Used pAC161
Line Availability only available from NASC (N433901)
Segregation Analysis 100:100:79
Confirmed for Hit At3g08010
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g08010

 
Sequence (A. th genome BLAST matches underlined)
>02-K016364-022-354-B01-8409
TGATCTGAAATTTCCCGGACTGAAGCCATTTACATTGAATATATCCTGAGAGACGAAACG
GCAGCGTTTCAACAGAGTTTCGGAGGAGAAGAGATGATGGGTTTTGATGGGTTTAGTAAA
AGAAGAGGGTTTACGGATTCTCGGAAGTGATGGTGTCTGGATTCGCCTTGTGTTAAAGCC
TAACGTCGCCATTGAAAAGGAGTAGGCTTTAGGAAGAAAGCAGAGGAAGAAGAAGAAGAA
ATGATTTATCCTTTTCGGTTACTCCTTCCTCATCCACAAAGATATTTCAATAATAAAATA
AGTTTTTTTTTGGTTGGGCNCCTAATTTTTGGGGGGCCCCTTATATAAATAAAAAAAACT
TCAAACCCAAAACAAAGCTTAAATTTGAAAAAACAAGTTTTTGTGATCATGATGAAAAAT
GGTATTGACTTATTAGTGAAACGAGTTTCAGCGATACCTCAACACTCTATTTCTTCTATG
GGATCCCCCCATAATAGGGAGGACNNNNCNCGCANTTTTCTNTTGCGTTCCTTTACCCAA
CCAAACGAAAAACGGCCCAACCCCCGACGCCCCCCCCGTTCCAACCCCCGCCCACACTAA
AGCANCTCCGCATAACGGCGAGAGCCGACGGCGCGCAACCTTATCGGCTATAAGGCCGCA
ACGCGCCGACCATCGAAACCAAAGCCCCGGCTTTAGGTGCACGTATGAGCCGAAGCAAAA
CAACCTCCGGACGGGTGTCCTGATAAGCGCCAGCTGTGAGCCACTCAGGAGACCGCTAAA
ACCAGGCAGTGATACGATCCGCCATACGATAATAAACAACGCCGCTATAAAGGGACATAT
TCGCACCGCCCACGGACCGGTTAGCCGTGTCGAGGAAAT
GenBank Accession AL953725 [GenBank]
Graphic View Graphic view of gene At3g08010
Predicted Position of Insertion Chr3:2556189 - go to primer design
BLAST e Value 3e-85
Hit Clone Code (BAC ID) F17A17
Hit Gene Code At3g08010 [TAIR] [MIPS] [SIGnAL]
Gene Annotation RNA binding
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL953726 [GenBank] AL953726 [GenBank]


Last Updated on 14.10.2014 10:23