Sequences from confirmation amplicon


Confirmation sequences for line 354B03 and hit At1g01390 are shown.
Line ID 354B03
Locus At1g01390 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:148977
Primers used for PCR MZ24 - 8474, show primer details
   
Sequence Name 14-K023834-022-354-B03C-8409
GenBank Accession LN492328 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>14-K023834-022-354-B03C-8409
CATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCTGAAGCCAACTTAA
ACATCCGAACTTGTCTTCCAAGTTAACATTAGATGAACTTGTGTTAACCAGCGGCCCAAT
CGGGTATACCGTTGGTTTATCAGGAGCCGGTTCTTGTAAGGCCTTTATTGCATTCGACTC
TAAATCAACGAAGGAATTCACTAGAATCCCTTTAGCTTCTTTGTACCTCTTGGTGTTATG
GAGAAGCAATTTGTATGCGTCGTCGTTTCGGTCTTGAACCGTATCAAGAAAGTCCTTACC
GGTTATCGGGACACAGCCGGGAATCTTAAGCGGTTCGGTTAAGTACCTAAACTCACACGA
CACCGTTTTGTCTAGTTTCGGCAAGTGAAGAAAAAACGACAAGACGTTTGCATTGGATGC
ATAGAAAATGTATGGTGACACGTGGAAGTCAACGGCCACGTCGAACGCATCCGCACCAAA
CATATCGACGACGAGAACCGCCGGGAGACTTTTCT
   
Sequence Name 18-K023834-022-354-B03C-MZ24
GenBank Accession LN494138 [GenBank]
Sequencing primer gene specific primer, MZ24: 5'-TTTATCAACGAAGAAAAGTCTCCC-3'
Sequence (A. th genome BLAST matches underlined)
>18-K023834-022-354-B03C-MZ24
GGCGGTTCTCGTCGTCGATATGTTTGGTGCGGATGCGTTCGACGTGGCCGTTGACTTCCA
CGTGTCACCATACATTTTCTATGCATCCAATGCAAACGTCTTGTCGTTTTTTCTTCACTT
GCCGAAACTAGACAAAACGGTGTCGTGTGAGTTTAGGTACTTAACCGAACCGCTTAAGAT
TCCCGGCTGTGTCCCGATAACCGGTAAGGACTTTCTTGATACGGTTCAAGACCGAAACGA
CGACGCATACAAATTGCTTCTCCATAACACCAAGAGGTACAAAGAAGCTAAAGGGATTCT
AGTGAATTCCTTCGTTGATTTAGAGTCGAATGCAATAAAGGCCTTACAAGAACCGGCTCC
TGATAAACCAACGGTATACCCGATTGGGCCGCTGGTTAACACAAGTTCATCTAATGTTAA
CTTGGAAGACAAGTTCGGATGTTTAAGTTGGCTTCAGGATATATTCAATTGTAAATGGCT
TCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAG
AAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGTTATTATA
AAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAG
CAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTA

Last Updated on 07.07.2016 14:16