SimpleSearch - Line and FST details


Line specific information

 
Line ID 354B03
Vector Used pAC161
Line Availability only available from NASC (N433903)
Segregation Analysis 50:48:37
Confirmed for Hit At1g01390
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g01390

 
Sequence (A. th genome BLAST matches underlined)
>18-K016365-022-354-B03-8409
TATCCTGAAATTTCCCGGACTGAAGCCATTTACATTGAATATATACTGAAGCCAACTTAT
ACACTCCGAACTTGTCTTCCACAGTTAACATATAGGATGAACTGTGTGTTAACCAGCGGA
CCACTCCGGGTATACCGTATGGTTTATCAGGAGCCGGTTCTTGTAAGGCCTTTATTGCAT
TCGACTCTAAATCAACGAAGGAATTCACTATGGGATCCTCNGCTATAGTGAGANACCANN
AANAGCTTCTTNCCCTTACCTTTTACATGGATCAAATCGCCTATCTTGAAACATCTTGAT
GGTGCCTATGGGATCCACCCTATAGTGAGAACCACTAACACCAGAATTAAAGGACGGAAT
CCTGTGGCCCCTAATCCTAGGAGGGGAACAAATTTACTACTCTGTGGAAAATGCCCAGGT
GCCCTCAGGAATACTCACTATATTGAGCAACAACATTGCTAAAGCTCATGGTGGTGTATC
CGTATTTGGTGGAGTAGGCGAACGGACTCGTGAAGGAAATGATCTTTACATGGAAATGAA
AGAATCTGGAGTCATTAATGAACAAAATCTTGCGGAATCCAAAGTGGTCCTATGGGATCC
TCCCTATAAAGGAGAAGTNAAAGGAGAAAACGCCCCCAGGAGATTTCAACCAAGAAACGT
CCCACTAAATATGCAAGTTTGAAGCTTT
GenBank Accession FR808651 [GenBank]
Graphic View Graphic view of gene At1g01390
Predicted Position of Insertion Chr1:148977 - go to primer design
BLAST e Value 2e-45
Hit Clone Code (BAC ID) F6F3
Hit Gene Code At1g01390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-Glycosyltransferase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL953729 [GenBank]


Last Updated on 07.07.2016 14:03