Sequences from confirmation amplicon


Confirmation sequences for line 360C05 and hit At2g19190 are shown.
Line ID 360C05
Locus At2g19190 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:8326768
Primers used for PCR IS01 - 8474, show primer details
   
Sequence Name 33-K024208-022-360-C05C-IS01
GenBank Accession LN500836 [GenBank]
Sequencing primer gene specific primer, IS01: 5'-TCATAAATGGAGAACAAGTTGCTG-3'
Sequence (A. th genome BLAST matches underlined)
>33-K024208-022-360-C05C-IS01
GGTACTCTCTGAAGAATCAGCTCAAGGCTACAAAGAGTTTCGAGCAGAGGTTTTTTTTGC
GTACCTTTCAAGGACTTAATCTTAATTTATCTCAAACTTTTTCACCTAACTAATCTAGTT
GAGAATCGCAGGTTGACCTTCTCATGAGAGTTCATCACACGAACCTGACTTCTCTTGTTG
GATATTGCAACGAAATAAACCACATGGTGCTTATCTATGAGTATATGGCTAATGAGAACT
TAGGAGACTATTTGGCAGGTTAATTAATGATTCTTCTTTTGTTCACTAATCTTATGTTCA
TAATGTACTGAGAAAGGAACTTTGGTTTTGTTTCATTTTGTGAAGGTAAAAGGTCATTTA
TCTTGAGCTGGGAAGAGAGGTTGAAGATATCATTAGATGCAGCGCAAGGTTCGGGAAGTC
CCATCTTGAAATTACATTTAACTAAATCTAACATGCGAAAATCAATCAATGAAGTGTGTG
TTTTCTCTGTGAAAATCAATCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGAT
CAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTC
AATTCAAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAAC
GACAAATTACGATCCGTCGTATTTAT
   
Sequence Name 34-K024208-022-360-C05C-8409
GenBank Accession LN501258 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>34-K024208-022-360-C05C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGATTGATTTTCACAGAGAAAACACACAC
TTCATTGATTGATTTTCGCATGTTAGATTTAGTTAAATGTAATTTCAAGATGGGACTTCC
CGAACCTTGCGCTGCATCTAATGATATCTTCAACCTCTCTTCCCAGCTCAAGATAAATGA
CCTTTTACCTTCACAAAATGAAACAAAACCAAAGTTCCTTTCTCAGTACATTATGAACAT
AAGATTAGTGAACAAAAGAAGAATCATTAATTAACCTGCCAAATAGTCTCCTAAGTTCTC
ATTAGCCATATACTCATAGATAAGCACCATGTGGTTTATTTCGTTGCAATATCCAACAAG
AGAAGTCAGGTTCGTGTGATGAACTCTCATGAGAAGGTCAACCTGCGATTCTCAACTAGA
TTAGTTAGGTGAAAAAGTTTGAGATAAATTAAGATTAAGTCCTTGAAAGGTACGCAAAAA
AAACCTCTGCTCGAAACTCTTTGTAGCCTTGAGCTGATTCTTCAGAGAGTACCTTGACAG
CAACTT

Last Updated on 23.10.2014 13:25