SimpleSearch - Line and FST details


Line specific information

 
Line ID 360C05
Vector Used pAC161
Line Availability only available from NASC (N434493)
Segregation Analysis 50:50:49
Confirmed for Hit At2g19190
Parent of DUPLO pair none
Parent of pair(s) 6743, 6745, 7896, 10742, 10744, 72898, 72899, 72900, 72901, 72902, 72903, 72905, 72906, 72910, 72913, 72914, 72916, 72917, 72918, 72919, 72920, 72921, 72922, 72926, 72930, 72932

Gene hit At2g19190

 
Sequence (A. th genome BLAST matches underlined)
>35-K016880-022-360-C05-8409
GATCATGAAATTTCCCGGACTGAAGCCATTTACAATTGATTGATTTTCACATGAGAAAAC
ACTCACTTCATTGATTGATTGTCGCATGTTAGATTTAGTTAAATGTAATTTCAAGATGGG
ACTTCCCGAACCTTGCGCTGCATCTAATGATATCTTCAACCTCTCTTCCCAGCTCAAGAT
AAATGACCTTTTACNCTTCACAAAAGGAAACAAAACCAAAGTTCCTTTCTCAGTACATTA
TGAACATAAGATTAGTGAACAAAAGAAGAATCATTAATTAACCTGCCAAATAGTCTCCTA
AGTTCTCATTAGCCATATACTCATAGATAAGCACCATGTGGTTTATTTCGTTGCAATATC
CAACAAGAGAAGTCAGGTTCGTGTGATGAACTCTCATGAGAAGGTCAACCTGCGATTCTC
AACTATGGGAGCCCGCCTAATAGCTGAGATCGCATGATATTACCGAGATGTCCCCACGGG
CATCTTTTCACCTCGTCGCCGAAGAGAATGGGCGTGTCATGCATGGGCTGACATGGATTC
TCCTATGGGA
GenBank Accession BX001959 [GenBank]
Graphic View Graphic view of gene At2g19190
Predicted Position of Insertion Chr2:8326768 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T20K24
Hit Gene Code At2g19190 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FLG22-induced receptor-like kinase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03