Sequences from confirmation amplicon


Confirmation sequences for line 368D01 and hit At1g20970 are shown.
Line ID 368D01
Locus At1g20970 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:7316573
Primers used for PCR RP10 - 8474, show primer details
   
Sequence Name 11-K024285-022-368-D01C-RP10
GenBank Accession LN490938 [GenBank]
Sequencing primer gene specific primer, RP10: 5'-ATAAAGTTGTGTGCTGCATCGTAT-3'
Sequence (A. th genome BLAST matches underlined)
>11-K024285-022-368-D01C-RP10
ATATTACGCACCTGATTGGAGGCAGAGAAATAAGATAGATTAGCATAATCAAATTAGACA
AGCTAAAAACTTGAACAAAACTTAGCTGGAAATGTGATCATTGGGAGTCTCACCCTTGAA
TCAATATCATCAACAGACGCAGCACTTTTAACCCGGCTAATCATAGACTGAAGGGCCTCA
ATTTCCTGCCGTTTTGAATGCATTGCTTTTCTTGCAGATCTCTCTTCTGCCATGACCGCC
TTGTAACTGATATCATAGTCCTTACATATTGCCTAGAAATAACAATTTCAAAAAATGTCA
GAGGCAAATTTAGAACAAAGATGTTTTAGCATATGAAAATCTCAAAAGCGTTTCTTACGC
GTATCTTCTGGATATCCGCTCTAAGAGCATCCCGATTTTGTGTTTTCTGATCAACCTGCT
CTTCAGCATGCTTCAGTTGCTCGGCTAACTTTTCATCATCATATCTAGGAACTCTAGGCA
GAAAGTAAAAAGGTCTTTTCTCTATCTCTGCCGCTACAGTAAGCCCTTCAGAAGCATCAA
GTACAGAAACTTCACCGGTCGAGGCTACTTTATCATCTGTTCTATCAACAACATTTCCTG
AACACAACAATTTATATATACTGTCAACTCCATCCTTCTGATTCTCAACAAGAGAAGTAC
ATAGCCTAATTTCATTTTTAATTAACTTATTACCTTCTTTACAATTGTAAATGGCTTCAT
GTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATA
   
Sequence Name 12-K024285-022-368-D01C-8409
GenBank Accession LN491397 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>12-K024285-022-368-D01C-8409
TAGATTTCCCGGACATGAAGCCATTTACAATTGTAAAGAAGGTAATAAGTTAATTAAAAA
TGAAATTAGGCTATGTACTTCTCTTGTTGAGAATCAGAAGGATGGAGTTGACAGTATATA
TAAATTGTTGTGTTCAGGAAATGTTGTTGATAGAACAGATGATAAAGTAGCCTCGACCGG
TGAAGTTTCTGTACTTGATGCTTCTGAAGGGCTTACTGTAGCGGCAGAGATAGAGAAAAG
ACCTTTTTACTTTCTGCCTAGAGTTCCTAGATATGATGATGAAAAGTTAGCCGAGCAACT
GAAGCATGCTGAAGAGCAGGTTGATCAGAAAACACAAAATCGGGATGCTCTTAGAGCGGA
TATCCAGAAGATACGCGTAAGAAACGCTTTTGAGATTTTCATATGCTAAAACATCTTTGT
TCTAAATTTGCCTCTGACATTTTTTGAAATTGTTATTTCTAGGCAATATGTAAGGACTAT
GATATCAGTTACAAGGCGGTCATGGCAGAAGAGAGATCTGCAAGAAAAGCAATGCATTCA
AAACGGCAGGAAATTGAGGCCCTTCAGTCTATGATTAGCCGGGTTAAAAGTGCTGCGTCT
GTTGATGATATTGATTCAAGGGTGAGACTCCCAATGATCACATTTCCAGCTAAGTTTTGT
TCAAGTTTTTAGCTTGTCTAATTTGATTATGCTAATCTATCTTATTTCTCTGCCTCCAAT
CAGGTGCGTAATATGGAACAT

Last Updated on 07.07.2016 14:16