SimpleSearch - Line and FST details


Line specific information

 
Line ID 368D01
Vector Used pAC161
Line Availability only available from NASC (N435269)
Segregation Analysis 50:49:46
Confirmed for Hit At1g20970
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g20970

 
Sequence (A. th genome BLAST matches underlined)
>04-K017042-022-368-D01-8409
TGTCCTGAAATTTCCCGGACTGAAGCCATTTAAATTGTTGTATTCGAGAGATCCTAGTTG
CTACTTTAGAGTGTCCAAACACTATGTCTCTGGTCTCATTAAACACGCAATTATTAACAT
ACTACATCTCTCAGCATGCAAATATTTATCGCTATGGGATCCTCCCTATAGTGAGAGCTC
TCGACAGGGGAAGTTTCTCGTCTTGATGCTTGTGAAGGGCTTACTGTAGCGGCGTATTAA
GAAAAAAGACCGTTCTACTTGCTGTCTATGGAATCTTCCCGAGAATGGGAGGCCGACGTA
TCTACCACGGTGGCCTTACGTATATTCCAATGAGGGCATTCGTATGACCCACCTATGTTT
TCCGCTATATTCACCTTCCGTGACAGATATCTGGGCAATGGAATCCGAAGAGGTGTCCAG
AGATTACCCATGGTGGAAACGGCTCATTTGCTCTGTGGACAACTGACACTGGATCTTTGA
TATTCTTGGACTGGATCATTGAGACTTGCTCCACCAAGAAGACTAACATGCTCTTCTTTG
CATAGAATCATAATAGACTCTGCATGAACTG
GenBank Accession BX002952 [GenBank]
Graphic View Graphic view of gene At1g20970
Predicted Position of Insertion Chr1:7316589 - go to primer design
BLAST e Value 1e-07
Hit Clone Code (BAC ID) F9H16
Hit Gene Code At1g20970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation calponin-like domain protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX002952 [GenBank]


Last Updated on 31.08.2016 09:40