Sequences from confirmation amplicon


Confirmation sequences for line 368E05 and hit At2g33560 are shown.
Line ID 368E05
Locus At2g33560 [Araport] [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr2:14216016
Primers used for PCR IL01 - 8474, show primer details
   
Sequence Name 17-K022407-022-368-E05C-8409
GenBank Accession LN493682 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>17-K022407-022-368-E05C-8409
TATGCGTACATCAAAGCAAAAAGTTGCGAAGCTCTCTCATTGAGTAAACTAACGGCTATA
TTCTCTCTGATATTCAAAATTTGCTCGAAGAAACGACGATGGCAGCCGAAACGAAGGTTC
AGGTTTCAGATCCAGAGGCAGAGTTTCTTAATTCGAAGCAGGAGACTGGATACGAGTGGG
AGCTTTTCAAGGAGAACGTCCGGCCATTGAAGAGAGGTCGCAATGTTGGTATTCTCAACC
ACGCTCTCAAATCTCACTCTGACCACCAATTGAGAAAGAATCTCATCGAGAAACGCAGGT
ACTGATTTCAATCTCACATCTTTGCTCTTGGGTTTTAGTCTAATCGCTCGATTCTTGTCT
AATTTTGTGTTGTTTTTGTGAATTAGGAATTTGATTGAAGCCATTGATGAGTATGAAGGA
GATGACCCTTTATCTCCATGGATAGAGTGAGTTCCTTTTATCAT
   
Sequence Name 18-K022407-022-368-E05C-IL01
GenBank Accession LN494130 [GenBank]
Sequencing primer gene specific primer, IL01: 5'-CCCAATCAAGAATGATAAAAGGAA-3'
Sequence (A. th genome BLAST matches underlined)
>18-K022407-022-368-E05C-IL01
CACTCTATCCATGGAGATAAAGGGTCATCTCCTTCATACTCATCAATGGCTTCAATCAAA
TTCCTAATTCACAAAAACAACACAAAATTAGACAAGAATCGAGCGATTAGACTAAAACCC
AAGAGCAAAGATGTGAGATTGAAATCAGTACCTGCGTTTCTCGATGAGATTCTTTCTCAA
TTGGTGGTCAGAGTGAGATTTGAGAGCGTGGTTGAGAATACCAACATTGCGACCTCTCTT
CAATGGCCGGACGTTCTCCTTGAAAAGCTCCCACTCGTATCCAGTCTCCTGCTTCGAATT
AAGAAACTCTGCCTCTGGATCTGAAACCTGAACCTTCGTTTCGGCTGCCATCGTCGTTTC
TTCGAGCAAATTTTGAATATCAGAGAGAATATAGCCGTTAGTTTACTCAATGAGAGAGCT
TCGCAACTTTTTGCTTTGATGTACGCATACTCGGAGCAATGAGTATGATGGTCAATATGG
AGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCG
TTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATA
GGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACAT

Last Updated on 07.07.2016 14:16