SimpleSearch - Line and FST details


Line specific information

 
Line ID 368E05
Vector Used pAC161
Line Availability only available from NASC (N435285)
Segregation Analysis 100:97:72
Confirmed for Hit At2g33560
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g33560

 
Sequence (A. th genome BLAST matches underlined)
>37-K017042-022-368-E05-8409
CTAACAGCTATATTCTCTCTGAATTCCAAATTTGCTCGAAGACACGACGATGGCAATCCA
AACGACCGTTCAGGTTTCGCATCCAGACGCAGAGTTCCTTACTTCGAAGCTTGAGATTGC
ATAGCCAATGTGACCTTTTCTCGGACAACCTCCCGTCATTGAACATAAGTCCCAATGTTG
GTATTCTCAACATCCCTCTCATCTCTCACTCTGACCTCCGGTTGACTACCNAATCTCGTC
AAGAAACGCAGGTACTGATTTCAATCTCACATCTTTGCTCTTGGGTTTTAGTCTAATCGC
TCGATTCTTGTCTAATTTTGTGTTGTTTTTGTGAATTAGGAATTTGATTGAAGCCATTGA
TGAGTATGAAGGAGATGACCCTTTATCTCCATGGATAGAGTGAGTTCCTTTTATCATTCT
TGATTGGGTTGTTGAAAAATTGAAATTTTTCTTGAACCAATCTTTATGCTGTGACCAATT
TGTAAACTGAGCTTCTTAATTGGTTTCTTTGGAAGGTGTATAAAATGGGTACAAGAGGCT
TTTCCACCAGGAGGAGAATGTTCAGGACTGTTAGTGATATATGAGCAATGTGTTCGTAAA
TTTTGGCACTCTGAACGTTACAAGGATGATCTTCGTTATCTTAAAGTCTGGTTGGAATAT
GTAATGATTCTATCTTTAATTAACCC
GenBank Accession BX002979 [GenBank]
Graphic View Graphic view of gene At2g33560
Predicted Position of Insertion Chr2:14215968 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F4P9
Hit Gene Code At2g33560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BUB1-related (BUB1: budding uninhibited by benzymidazol 1)
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX002979 [GenBank]


Last Updated on 31.08.2016 09:40