Sequences from confirmation amplicon


Confirmation sequences for line 371F05 and hit At1g79750 are shown.
Line ID 371F05
Locus At1g79750 [TAIR] [MIPS] [SIGnAL]
Deduced position of insertion Chr1:30007841
Primers used for PCR RU01 - 8474, show primer details
   
Sequence Name 07-K023618-022-371-F05C-8409
GenBank Accession LN489083 [GenBank]
Sequencing primer T-DNA primer, 8409: 5'-ATATTGACCATCATACTCATTGC-3'
Sequence (A. th genome BLAST matches underlined)
>07-K023618-022-371-F05C-8409
GATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCCGGACATGAAGCCATTACAT
CAGGCAACACAACTACTTACCCAGTTCGTAGGCCTTGGCAGCCACCTTAGCTGCAATACG
AGCTGAGATTTTTCTGATATTCCTGAAGGGAGGGTATATCATCCCCTTCTCATAGTGTTC
CTCCATCAGTTCCTCAGCCAAAGCTTCTGATGCTGCCAGAAGCATGTCATCATGGACACG
GATCGTCCCTGACATTATTAGCCCGAGTCCAAACCCAGGGAAGATGTATGCGTTGTTTGC
CTGTCCACATAAACGTCAGAATCAACTCTCTTAAATTACTTGTCAAATCCTATTCTACAG
CTGTGGTCACAACCTGTCCAGGCACAAACGTCTTTCCCTCATACTCTACTGGCGCAAATG
GGCTTCCACTTGCAAAGATCGCCCGTCCCTGTAAAAATAGTTTGACTTTGTAAGTCAACG
ACAATACTCCACTTCTCTCTGATCATGAGAAATCACAATCTTAACTCGTTTACCTGACTC
CACGTATAGGCCTCTTCTGCCGTACATTCTGACTGAGAAGTTGGGTTCGAAAGAGAAAG
   
Sequence Name 08-K023618-022-371-F05C-RU01
GenBank Accession LN489549 [GenBank]
Sequencing primer gene specific primer, RU01: 5'-CAGAAACCCATCATTCTTTCTCTT-3'
Sequence (A. th genome BLAST matches underlined)
>08-K023618-022-371-F05C-ru1
AACCAACTTCTCAGTCAGAATGTACGGCAGAAGAGGCCTATACGTGGAGTCAGGTAAACG
AGTTAAGATTGTGATTTCTCATGATCAGAGAGAAGTGGAGTATTGTCGTTGACTTACAAA
GTCAAACTATTTTTACAGGGACGGGCGATCTTTGCAAGTGGAAGCCCATTTGCGCCAGTA
GAGTATGAGGGAAAGACGTTTGTGCCTGGACAGGTTGTGACCACAGCTGTAGAATAGGAT
TTGACAAGTAATTTAAGAGAGTTGATTCTGACGTTTATGTGGACAGGCAAACAACGCATA
CATCTTCCCTGGGTTTGGACTCGGGCTAATAATGTCAGGGACGATCCGTGTCCATGATGA
CATGCTTCTGGCAGCATCAGAAGCTTTGGCTGAGGAACTGATGGAGGAACACTATGAGAA
GGGGATGATATACCCTCCCTTCAGGAATATCAGAAAAATCTCAGCTCGTATTGCAGCTAA
GGTGGCTGCCAAGGCCTACGAACTGGGTAAGTAGTTGTGTTGCCTGATGTAATGGCTTCA
TGTCCGGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCA
ATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTC
AAAAATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAA
ATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATC
TTT

Last Updated on 23.10.2014 13:25