SimpleSearch - Line and FST details


Line specific information

 
Line ID 371F05
Vector Used pAC161
Line Availability only available from NASC (N435585)
Segregation Analysis 50:50:46
Confirmed for Hit At1g79750
Parent of DUPLO pair none
Parent of pair(s) 3639, 3657, 3698

Gene hit At1g79750

 
Sequence (A. th genome BLAST matches underlined)
>38-K017095-022-371-F05-8409
TATCCTGATATTTCCCGGACTGAAGCCATTTAAATTGAATATATCTCAGAGATCGTATCC
ATCCTATCACCCTAAACCTTTTCGCTTATACGAATCAGGCAGCCGTCCAAACCTCTCTCT
TTGACGAAAAAATATATTATCTGATATCTCGCCGAATGGAGAGGGATATCATCACCTTCT
CATATCGTTCCTCCCTCAGTTCCTCTCCCATAGCTTCTGATGCTGCCAAAAGCATGTCAT
CACGGACACTGATCGTCCCTGACATTATTAGCCCGAGTCCAAACCCTTGGAAAATGTATG
CGTTGTATTGCCTGTCCACATAAACCTCAGAATCAACTCTCTTAAATTACTTGTCAAAAC
CTATTCTACAGCTGCGGTCACAACCTGTCCAGGCACAAACGCCTTTCCCTCATACTCTAC
TGAGACATATGGTCTTCGACTTGCAAAGATCGCCCGTCCCTGTAAAACTAGTTTGACTTT
GTAAAGTCAACGACAATACTCCACTTCTCTCTGATCATGAAAAATCACAATCTTAACTCG
TTTACCTGACTCCACGTATAGGCCTCTTCTGCCGTACATTCTGACTGAGAAGTTGGGTTC
GAAAGAGAAAGAATGATGGGTTTCTGTATGCACCAAATTTGACTTTATGGTCATGACTAT
GCGCTCCTA
GenBank Accession BX003388 [GenBank]
Graphic View Graphic view of gene At1g79750
Predicted Position of Insertion Chr1:30007837 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F20B17
Hit Gene Code At1g79750 [TAIR] [MIPS] [SIGnAL]
Gene Annotation NADP-malic enzyme 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g19680

 
Sequence (A. th genome BLAST matches underlined)
>38-K017074-022-371-F05-8409
CTCCCTACTATTGAGATATACATAAAGATCGTATCCATCCTATAACCCTAAATCTTTTTG
CTTATTCGAATCTGTTAGCCATCCAAAACCTCTCTCTTTGCCGCAAAAAATGACTATGGG
ATCCTGCCTATAGGGGAGCACAGGCAAAATGTATGGCTTGCTTACAATCACCGATTCATT
CGTCTTTTATTTCGTTTAATATTCAGATATTTTGGTCTAAAATTCTTCTTCGCTCTTTTG
GATTTTGGATTTTAAGGATTTATAGGTTGATTATTTATGTGTTAGAGTCTCAAATCGAAT
TTGAAATCTCTTCACTGCGATAATGCTTTTTAGGTTATGAATTGCTTAATTTTTCCATAA
TTCGGATTCCCTCGATTTGCTAGTCGGGAATTGAGGGCTATAGGATCCTCCCTATATGGA
GACGCAGCTTTACGGTCGACTTCAGTTACGTCCGCTATTTGAATCTATAACTCCATGGGA
ATTGGGGATCCGATATGGGATCTT
GenBank Accession BX003387 [GenBank]
Graphic View Graphic view of gene At2g19680
Predicted Position of Insertion Chr2:8501257 - go to primer design
BLAST e Value 4e-93
Hit Clone Code (BAC ID) F6F22
Hit Gene Code At2g19680 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mitochondrial ATP synthase subunit G protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 14.10.2014 10:23